header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22300
Transcript Name: myh7bb-202
Previous Names: myh7bb-001, si:ch211-209j10.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042600 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042600|OTTDARG00000030701|ZDB-GENE-090311-5 myh7bb|OTTDARP00000033851 myh7bb-001 LG_ CR847953.10 Danio rerio protein_coding KNOWN, 6253 bp
CGGAACACTTGTTTCGAGTCCAACGCTTTTAGACGTTACT
GAGGTGCTTGAGTGCAGGTCCGGGACCGGAAGAGTTAATC
ATGTCCCGTTTTATGGAACTGAGGGAGTTTGGAGAGGCGG
CCACATTTCTGCGTAAAACCAACCTGGAGCAACTCGCCGC
GCAGTCCCATGCGTTTGATGGGAAGAAGCGTGTTTGGATT
CCAGATGAGAAGGAAGCATACATTGAGGTGGAGATCAAAG
ATACAGATGGAGACAAAGTCATGGTGGAGACCAAAGATGG
AAGGATGTTAACAGTGAAAGAGGAAGATATTCAGCAGATG
AATCCGCCAAAGTTTGACTTGATGGAAGACATGGCCATGC
TCACGCACCTCAATGAGGCCTCGGTTCTTTTCAACCTCAG
CCGTCGCTACAGTTTTTGGATGATCTATACATATTCAGGG
TTGTTTTGTGTGACAGTAAACCCGTATAAATGGCTTCCCG
TCTACTCTTCTGAAGTGGTTGCAGCATATAAGGGAAAGCG
TCGCTCAGATGTTCCACCTCACATCTATTCCATAGCAGAC
AATGCCTACAATGACATGCTAAAAAATCGTGAAAACCAGT
CAATGCTTATCACCGGAGAATCCGGTGCTGGCAAAACTGT
CAACACGAAACGTGTAATTCAGTATTTTGCCATTATAGCT
GCTCTTGGCGAAGCAGGGGGCAAAAAAGGAGGTACATTAG
AAGATCAGATCATTGAGGCCAACCCGGCTATGGAAGCTTT
TGGCAATGCAAAAACCCTGAGGAATGACAACTCATCCCGC
TTTGGAAAATTCATACGCATCCATTTTGGTCCTACAGGGA
AGCTTGCATCTGCTGACATTGACATCTACCTTCTGGAAAA
ATCCAGAGTGATTTTTCAGCAAACAGGAGAGAGAAGCTAC
CACATCTATTACCAGATCCTCTCGCACAGGAAACCAGAAC
TCCAAGACATGCTGCTGGTGTCATCAAATCCCTTCGATTA
CCACTTCTGCTCGCAGGGTGTTATAACTGTGGACAACATG
GATGACGGCGATGAGCTGCTCGCGACTGATCATGCGATGG
ACACTCTTGGATTCACTCCTGAGGAGAAGTATGGCTGCTA
CAAGATAGTCGGTGGCATCATGCACTTTGGCAACATGAAG
TTCAAAGTGAAGCAGAGAGAGGAGCAAGCAGAAGCAGACG
GCACTGAAAGTGCGGACAAAGCATCCTATCTCATGGGGAT
CAGTTCAGCTGACCTCATAAAGGGACTGCTTCACCCTCGA
GTGAAAGTGGGCAATGAGTACATTGTCAGAGGACAGACAG
TTGAACAGGTGACCTATGCTGTTGGTGCTTTGGCGAAAGC
TACATATGACCGCATGTTTAAATGGCTGGTGGGCAGAATT
AATAAAACTCTGTATACGGCCATCCCACGTCAGTTCTTCA
TAGGAGTGCTGGACATAGCAGGCTTTGAGATCTTTGAGTT
CAACAACTTTGAGCAGATGTGTATCAACTTCACCAATGAA
AAACTGCAACAGTTTTTCAACCATCACATGTTTATCCTCG
AGCAAGAAGAGTACAAAACAGAGGGCATTGAATGGACTTT
CATAGACTTCGGATTAGACCTGCAGGCCTGCATTGACCTC
ATTGAGAAGCCATTGGGAATACTGTCTATTCTGGAGGAGG
AGTGCATGTTCCCTAAAGCCACGGAGAGCAGCTTCAAAGC
GAAACTCTATGATAATCTCCTCGGCAAGTCTCCCAATTTC
CTGAAACCGAGGCCAGACAAAAAACGCAAATACGACACAC
ACTTTGAGCTGGTGCATTACGCTGGAGTGGTGCCGTACAA
CATCAATGGGTGGCTCGACAAGAACCGAGATCCTCTGAAT
GAAACAGTGGTTGGGATCTTTCAGAGGTCGTCCAACAAGT
TAATGTCAAGCCTGTTCGAGAACTTCATCAGCTTAGATTC
AGGTTCAGAAGCAAAGCCTGGGAGCAAAGAGAAGAGGAAG
AAAGGAGCATCATTCCAAACAGTGTCCCAGCTGCACAAGG
AGAATCTAAACAAGCTGATGACTAATTTGAGAAGCACTCA
GCCTCATTTTGTGCGATGCATTATTCCCAATGAAGCCAAG
AACCCAGGCATGATGGAGCCATTTTTGGTTTTGCACCAGC
TTCGTTGCAATGGAGTTCTGGAAGGGATCCGCATTTGCAG
AAAAGGATTTCCAAACCGCATTCTCTATGCAGAGTTTAAA
CAACGCTACCGTATCCTGAACCCATTGGCCATCCCAGAGG
ACACGTATGTGGACAGCAGGAAAGCTGTGGAGAAATTGCT
TGGGTCTCTGGATATTGACCACACGCAGTACAAGTTTGGC
CACAGCAAGGTCTTCTTCAAAGCTGGACTACTTGGACAGC
TGGAGGACATGAGGGATGAACGGCTTTCTAAAGTGCTCAC
CTTGTTGCAGGCCTTCTGCAGGGGCAAACTCATGCGGATG
GAGCGCAAGAGGATGATGAAGGAGAAGGAAGCTCTAATGG
TGATTCAATGGAACATTCGGGCCTTTTATGCAGTGAAGAA
CTGGCCGTGGATGTGTCTGTTCTTCAAGATCAAGCCACTG
TTGAGGAGCGCAGCTACAGAAAAGGAGCTTGCAACACTGA
AGGAGGAGTTTCAGAAGCTAAAGGAGGCTCTGGAGAGATC
TGAGGTGAAGAGGAAGGAGTTAGAGGAGAAACAGGTGTCT
TTGGTACAAGAGAAAAATGACCTGTCATTACAACTTCAAG
CTGAGCAGGATAACCTGGCTGACGCTGAGGATCGTTGTAA
CCTGCTGATCAAGGCTAAGATCCAGATGGAGGGGAAAATT
AAGGAGCTGATGGAGAGGCTGGAGGATGAAGAGGAGATGA
ACGCCACCATCCTAGCCAAGAAACGCAAACTTGAGGATGA
GTGTATCGAGCTGAAGAAAGACCTGGATGATCTGGAGATT
ACTCTGGCCAAGGTGGAGAAGGAAAAGCATGCTACTGAGA
ACAAGGTGAAAAACTTAGTGGAGGAAATGGCAGCATTGGA
TGAAACCATCTCCAGGCTAAGTAAAGAGAAGAAAGCCCTC
CAGGATGCCCACCAGCAGGCTCTGGAAGACCTGCAGTCTG
AGGAGAACAAAGTGAACATGCTGTCAAAGGCCAAGATCAA
GCTGGAGCAGCAGGTGGATGATTTAGAGGGCTCATTGGAG
CAAGAGAAGAAAGTGCGTATGGATCTGGAACGAGTAAAGC
GAAAGCTTGAGGGAGATCTGAAGCTTTCCGTTGAGTCATC
CATGGATTTAGATAACAGCAAACAGCAGCTGGAGGAAAGA
CTGAAGAAGAAAGACCATGAAATGGTTCAAATAGGTGCAA
AGATCGAAGAGGAGCAAGCCTTGGTTATTCAACTACATAA
GAAAATAAAAGAATTACAGACACGTATAGAAGAGCTAGAG
GAGGAACTTGAGGCTGAGAGAGCAGCTCGATCAAAGTCAG
AAAAGCAGCGCAGTGATGTGTCCAGAGAACTGGAAGAGCT
AAGTGAACGTCTGGAGGAAGCAGGAGGTGCTACTACTGCT
CAGATCGAGATGAACAAGAAGCGCGAGGCTGACTTTATAA
AGCTGCGCAGAGACCTGGAAGAAGCCTCGCTGCATCATGA
AACCACTATAGCCATGCTACGGAGAAAGCATGCAGACACG
GTGGCTGAGATGGGGGAGCAACTGGACAACCTGCAGAGGG
TCAAACAGAAGCTGGAGAAGGAAAAGGCAGAAACCAGAAT
GGAGTGTGAAGATCTGGCATCTAATGTGGAACATCTCTCC
AGAGCCAAAACTACAACAGAGAAGATGTGCAGGATGTATG
AGGATCAGTTAAATGAGTCTAAAACCAAGATTGAGGAACT
GCAGAGGCAGCTAATGGATGTCACTTCTCAAAAGGCACGG
GCCCAGACAGAGAGTGCTGAGGTCAGTCGCAGGCTGGAAG
AGAAAGAGGTTCTGGTCATGCAACTGCAGAGGACGAAGAT
CGCTTTCAGCCAAACTGTGGAAGAGCTGAAGAAACAGCTA
GAGGAGGAATCCAAAGCAAAGAACAGTTTAGCTCATGCGG
TACAGTCATCAAGGCATGACTGTGATCTCCTGAGAGAGCA
GTTCGAGGAGGAGCAGGAGGCCAAATCCGAGTTGCAGCGT
GCTCTGTCGAAAGCCAACATTGAGATCGCACAGTGGAGGA
CAAAGTATGAGACTGATGCCATTCAGAGGACTGATGAACT
AGAGGACGCCAAGAAGAAGCTGGTTGCACGACTCCAGGGC
TCTGAGGAGGCAGTGGAAGCATCCAATGCTAAATGTGCCT
CGCTGGAGAAGACCAAGCACCGTCTGCAGACTGAGATCGA
GGACTTGATGGTTGACTTGGAACGCTCTAATGCTGTGGCC
ATTGCACTGGACAAAAAGCAACGCAATTTTGATAAGGTGC
TGTCTGAGTGGAGGCAGAAGTTTGAGGAGACACAGTCCGA
GCTGGAAGGCTCTCAGAAAGAGTCCCGAAGCCTCAGCACA
GAGCTCTTTAAACTCAAAAACTCCTATGAAGAAGCCCTTG
ACCAGCTGGAGACTATCAAACGGGAGAACAAGAATTTGCA
AGAGGAAATAACTGACTTGACTGATCAGATTAGTCAAGGC
AACAAGACCATCCATGAGCTCGAACAGATGAAGAAGGTTC
TTGACCATGAGAAGTGTGACATTCAAGCAGCACTGGAGGA
GGCAGAGGGCACTCTGGAGCATGAGGAGAGTAAGACTTTA
CGCGTGCAGCTGGAGCTCAGCCAGACCAAGACTGAAGTTG
AGAAGAAACTTGCAGAGAGAGATGAGGAGATTGACAATCT
CCGTCGAAACCATCAGCGGACTCTGGAGGGCATGCAGACC
ACGCTGGATGCAGAGACCAGAGCACGTAATGAGGCAATCA
GGGTTAAGAAAAAGATGGAGAATGATATGAATGAGATGGA
GATCCATCTGAACCATGCGAACAGACAGGCTGTGGAGTCA
CAGAAAATGGTTCGCAATCTACAGCTTCAAATCAAGGACC
TGCAGGTAGAGTTAGATGAGTCTATGCATCATTGTGAGGA
GCTGAAGGAGCAGGTGGCAGTGACAGAGAGGAGAAACACG
CTGCTGTCAGCAGAACTGGAGGAGCTGCGTGGTGTAGCTG
AGCAAACAGATCGAATGCGTAAAGTGGCTGAGCACGAGCT
ACTGGAGTCCAGCGAGAGAGTTAACCTGCTGCACGCTCAG
AACACCGTAATGTTGAACCAGAAGAAGAAGTTGGAGAGTG
ATTTGTCCATGCTGTCTGGAGAAGTGGATGACGCTCAGCA
GGAGTGTCGCAATGCTGAAGAGAAGGCAAAGAAGGCCATA
ACTGATGCAGCCATGATGGCGGAGGAACTGAAGAAGGAGC
AGGACACCAGCAGCCACCTGGAGAGGATGAAGAGGAACAT
GGAGCAGACCATCAAAGACCTGCAGAACCGGCTGGATGAG
GCGGAGCAGATTGCTCTCAAGGGGGGAAAAAAACAGATTC
AGAAAATGGAAATTCGGGTGCGGGAACTGGAGACAGAGCT
GGACTGTGAGCAGAAGAAGAGTGCAGAGTTCCAGAAAGGA
ATACGAAAATATGAGAGGAGGATTAAAGAGCTTACCTATC
AGACAGAGGAGGACAGGAAAACTCTCCTGAGAATGCAGGA
CCTGATTGACAAACTTCAGGCTAAAGTAAAGAGCTTCAAG
AGACAAGCTGAGGACGCGGAGGAGCAGGTGAACTGCAACA
TGACTCGGTTCCGAAAGATCCAGCATGATCTGGATGAGGC
AGAGGAGAGGGCAGACATGGCTGAATCTCAAGTCAACAAG
CTGCGTGTCCGCACCAGAGAGACTCATGTCGTCAAGGTCG
TGGAGTGACGACTGACTTAAGCAGATGACTTACTAGAGTC
ATAGCGTGTGACGAGTACCTTTCCTTCTATTTGGTCTTCG
TAAAATGCTGCAAGACACAGTTTTTGGAAATGTTTAATGC
TTACTGAATGTCAATGCTTATTTTCAGATGTAAAACTTTA
GTCTTCAAAAGTTTTTGTTCTTATGTCTGTCTTGGGACAG
GCTCAGTCCGCAGAGCTCCTAATTAGCAGTTTTAATCACA
GTGCAGTTACAGTACAGCTGAAGGTTGTTTTTCTTTAGCC
TTCTGTAGCATCTGATTTGAAACTGGAGCTTTATGGACAG
GTTGTTTGAAAAGTTATTTGGATATTATAAACAAAACAGC
ACTTAATTGGTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh7bb-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000042600 (1),  Ensembl_Trans:ENSDART00000137438 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE325182 (1) 898 bp
GenBank:CT688748 (1) 856 bp
GenBank:EE306387 (1) 856 bp
GenBank:CT585724 (1) 769 bp
GenBank:DT073954 (1) 766 bp
GenBank:EB891720 (1) 699 bp
GenBank:EB898372 (1) 679 bp
GenBank:EB898020 (1) 623 bp
GenBank:EB887614 (1) 588 bp
CITATIONS (2)