Transcript

plxna2-201

ID
ZDB-TSCRIPT-090929-22262
Name
plxna2-201
Previous Names
  • plxna2-001
  • si:dkey-164k14.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042559 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042559|OTTDARG00000030675|ZDB-GENE-090311-6 plxna2|OTTDARP00000033824 DKEY-164K14.1-001 LG_none CR678070.11,CR753882.4,BX470150.13 Danio rerio protein_coding NOVEL, 5553 bp
TTCAACCACCTGACAGTTCACAAGACAACAGGGGCACTCT
ACATTGGTGCCGTCAACCGTGTCTACAAGTTATCAGGCAA
CCTAACACTATTAGTATCCCATGATACTGGTCCAGAAGAT
GACAACAAGGCTTGTTACCCTCCACTTATCGTTCAGCCTT
GCTCTGAACCACTGATTTCTACCAACAACATCAACAAACT
ATTACTCATTGATTACTCCCAGAATCGACTGCTTGCCTGT
GGAAGCCTCTACCAAGGTGTCTGCAAATTGCTACGGTTGG
ACGACCTCTTTATCCTGGTGGAACCCTCACACAAAAAGGA
GCATTACCTCTCCAGTGTCAACCAGACAGGCACAATGTAT
GGAGTCATTGTGCCCTCACAGGGTAAAGATGGGACCCTCT
TCATTGGTACTGCCGTGGACGGGAAGCAAGACTACTTTCC
AACAATCTCCAGCCGAAAGCTTCCACGTGACCCAGAGTCT
TCAGCGATGCTGGACTATGAGCTTCACACTGACTTTGTTT
CATCCCTTATCAAAATTCCTTCTGACACTCTGGCATTGGT
CTCTCATTTTGACATCTACTACATTTATGGCTTTGCTAGT
GGCAATTTTGTCTACTTTCTGACCGTTCAGCCTGAAACAC
CTGAGAACAGCATGTCTTCCAGTGGACCCTCAAATGACTT
GTTTTACACCTCTCGAATCGTCCGACTCTGCAAAGATGAC
CACAAGTTCCACTCCTATGTGTCTTTGCCTATTGGTTGTG
TTCGAAACAGAGTTGAATATCGCCTTCTGCAGGCAGCATA
TCTGGGCAAGCCTGGGAGAGTGTTTGCGGCATCCCTTAAC
ATCAGTGCTCAGGATGATGTGCTCTTTGCTGTCTTTTCCA
AAGGACAGAAACAGTACCACCATCCACCTGATGACTCTGC
CCTCTGCGTCTTTAGTATTCGGGACATTAATGCACGGATC
AAGGAGCGTATGCAGTCCTGCTATCAGGGAGAGGGGAACT
TGGAGCTCAACTGGCTGTTGGGAAAGGATGTACCTTGTAC
AAAAGCGCCTGTCCCTATTGATGACTCCTTCTGCGGTTTG
GACATCAACCAGCCCCTTGGCGGCTCTCAACTGGTGACCG
GGCACACACTTTATACAGAAAGCCGGGATCGCATGACTTC
GGTGACCTCCTATGTCTATAATGGCTTCTGCGTGGCTTTT
GTTGGCACCAAGAGTGGACGACTGAAAAAGATTCGGGTTG
ATGGTCCTCCTCAAGGCGGCGTCCAGTATGAAACTCTTTC
TGTCATCAAAGATGGAAACTCGATTCTCAGAGACATGGCC
TTTTCCCTGGACAACAGCTACATCTACGTCATGTCGGAGA
GACAGGTGACCCGGGTGCCGATCGAGTCCTGTGAGCAGTA
TAGCACATGCGGAGAGTGTCTGAGTTCAGGAGATCCACAC
TGCGGCTGGTGTGTCCTGCATAACATATGTTCTCAAAGAG
ATCGTTGTGAGCGGGCAAACGAGCCGTACCGCTTTGCCGC
CACGCTGAACCAGTGTGTGAAAGCTACAGTGTACCCAGAC
AGCATCGCCGTGTCTGAACCCAGCGTACCGCTGCTTGTGA
AAGTGACAGATGTTCCGGATCTTTCCGCTGGAATCACTTG
CTCCTTTGGGAACCTGACAGAGGTTGAGGGCCGAGTGAAT
GGCAATCAGATTCTCTGCATTTCTCCGGCTGCTAAAGATG
TTCCCATCATCCCCGCTGATCAAGACTGGTCAGGTGTGGA
GCTCAGGCTGAACTCCAAGGAAACGGGTCAGATGCTCATT
AGCACTGAGGTGAAGTTCTACAACTGCAGTGTACACCAGC
TGTGTCTTTCCTGTGTGACCAGTTCCTTCCGCTGCCACTG
GTGCAAGTACAGGAACCTCTGCACACATGACCCCTCCAGC
TGCTCCTTCCAGGAGGGACGAGTCAATGCCTCAGAGGACT
GCCCTCAACTGGTGCGCTCTGAGGAGATCCTGATCCCAGC
AGGAGAGGTGAAGCCCATCACCCTGAAAGCTCGGAACCTT
CCACAACCTCAGTCGGGGCAGCGCGGATACGAGTGTGTGT
TACACATTCAAGGAGTCAGTCACAGAGTCACGGCGCTCAG
ATTCAACAGCTCCAGCGTGCAGTGCCAAAACAGCTCGTAT
CTGTATGAAGGCATGAGAATTAGTGAGCTGCCTGTGGATT
TCTCAGTTGTCTGGAATGGAAACTTCATCATTGACAATCC
TGAGAACATCAAAGTGCACCTGTACAAATGTGGCGCTCAG
CGGGACAGCTGCGGTGTGTGTTTGAAGGCCGAGAGGAAGT
TTCAGTGTGGATGGTGCAGTATGGAGGGCCGATGTACCCT
GCGCCAGCACTGTCCCATGACCAACCCCTACACCAGCCGC
TGGCTACACCTCGCCAGCACCAATGTCAAGTGCACCAACC
CTCGAATCACCGAGGTAACCCCAGTGGCCGGACCACCAGA
AGGGGGCACCAGAGTGACCATCCGTGGTGTGAACCTGGGC
CTGTCCTTCTCTGACATGGTGAACAACGTGCAGGTGGCAG
GAGTCCAGTGTACGCCACAGGAGAACGGCTACATCATCGC
TGAACAGATTGTATGTGAAATGGATGCAGCTCCAGTGGAC
AGTAAAGCCGGACCGGTCCATTTGTGTGTAGGGGAGTGTA
AACCGGAGCTCCAGACTCGCTCTTCTCAGCTCTATTCCTT
TGTGATGCCATCGGTCACAGGTTTGTCTCCCAGTCGTGGT
CCGGAATCTGGAGGAACAAAAGTAACCATAATGGGGGAAA
ACCTGGGAGCAGGCAGCAGTGTCACTGTGCTTTTTGGGAA
CCAGACCTGCGAGTTTTACGAACGAACTATGACAGAGATT
GTGTGTTACTCTGCACCATCTCTGACGGGCGTGGGTTCGG
TTCAGATCAGCGTGAGTGTGGATCGCGCCCAAGTTCGAGA
CATCCTGGCTTTTGAGTATATAGACGACCCCACTGTTCAG
CGAATCGAGCCGGAATGGAGCATCGCAAGCGGACACACAC
CTCTGGTGGTGACCGGGACGAACTTGGATGTGATACAGGA
GCCGAGGATTCGGATCAAGTACGGCGGGCGGGAATCCGTA
AACGTGTGTAAAGTTCTCAACACCACCACTATGAGCTGTT
TCGCTCCCTCTCTGACGGCAGAGTACAGGCCTGGATTGGA
CTCAGTTAAACATGCGGACGAGTTTGGCTTTATTTTCAAC
AATGTCCAGGCTCTTCTAGTGTACAACAACACAAACTTCA
TGTACTACCCGAATCCTTTCTTTGAACCACTCAGCACCAA
TGGTGTTCTGGAGCAGAAACCTGGCTCACCTATCATTTTA
AAGGGTAAGAATCTGGTTCCTTCAGCCGCTGGAGGAGTGA
AGCTCAATTACACTGTTCTGATTGGAGAGACTCCCTGTTC
TGTCACTGTATCTGAGTCTCAACTGCTGTGCGAACCTCCA
AATCTTACCGGACAGTACAAAATCATGGTGCAGGTCGGTG
GTCTGCACGTGTCTCCCGGCTCAGTAAACATTCTCTCCGA
CAGCCTTCTGACTCTTCCTGCCATCGTGAGCATCGCGGCC
GGTGGAGGCCTTCTCCTCATCATCGTCATCCTTGTGCTCA
TTGCCTACAAGCGTAAATCCCGTGAGAACGACCTCACGCT
CAAGCGCCTTCAGATGCAGATGGACAACCTGGAGTCCAGG
GTCGCGCTGGAGTGCAAGGAAGCTTTTGCAGAACTGCAGA
CAGACATCAACGAGTTGACGAGTGATCTGGACCGGGCTGG
TATTCCCTATCTGGATTATCGCACATATGCCATGAGAGTG
TTATTCCCCGGCATTGAGGACCATCCTGTGCTCAGAGAGC
TGGAGGTCTCTGGTAACGGGCAGTTGTGTGTGGAAAAAGC
TCTGAAGCTGTTCGCCCAGCTGATAAACAACAAGGTGTTT
TTGCTGACGTTCATCCGTACACTGGAAATGCAGCGTTCGT
TCTCCATGCGTGATCGCGGTAACGTGGCGTCGCTCATCAT
GACGGCTCTACAGGGTCGACTGGAATACGCCACGGACGTC
CTCAAACACCTGCTGTCCGACCTCATCGACAAGAACCTAG
AGAGCAAAAACCATCCCAAACTACTGCTCAGGAGAACGGA
GTCTGTCGCTGAGAAGATGCTAACCAACTGGTTTGCTTTC
TTACTTCACAAGTTCCTGAAGGAGTGTGCAGGTGAGCCAC
TCTTCATGCTGTACTGTGCCATAAAACAGCAGATGGAAAA
AGGCCCAATAGACGCCATCACTGGAGAGGCCCGATACTCC
CTCAGCGAAGACAAACTCATCCGACAGCAGATCGACTACA
AGACGCTGATCTTAAACTGCGTCAACCCAGAGAACGAGAA
CAGCCCGGAGATCCCGGTCAAGGTTTTGAACTGTGACACC
ATCACGCAAGTCAAGGAAAAGATTCTGGATGCTGTGTATA
AAAACATGCCGTATTCACAGAGACCCAAAGCTGTAGACAT
GGACCTGGAGTGGCGTCAGGGACGGATGGCCCGCGTGGTC
CTGCAGGATGAAGACATCACCACCAAGATTGAAAATGATT
GGAAGAGGCTCAACACTCTCATGCACTATCAGGTGTCCGA
CCGCTGTGTAGTGGCTTTGGTGCCCAAGCAGACGTCCTCC
TACAACATTCCACCCACAACTAGCATCTCCCGGACATCTA
TCAGCAGATACGACTCAACATTCCGGTACACGGGCAGTCC
GGACAGCCTGCGCTCTCGTGCTCCAATGATTACTCCAGAT
CTGGAGAGCGGAGTCAAAGTCTGGCATCTGGTGAAGAACC
ATGAGCATGGGGACCAAAAGGAGGGCGACCGCGGCAGCAA
GATGGTATCTGAGATCTACCTCACCCGCCTGCTAGCTACT
AAGGGTACGCTACAGAAATTCGTGGATGACCTGTTCGAGA
CTCTTTTCAGTACAGTTCACAGAGGCAGTGCGCTTCCTTT
AGCAATCAAATATATGTTTGACTTCCTGGACGAGCAAGCG
GACAAGCATGGCATCCATGACACTGATGTCCGCCACACCT
GGAAAAGCAACTGCCTTCCTCTGCGCTTCTGGGTGAATGT
GATCAAGAACCCCCAGTTTGTTTTTGACATTCATAAGAGC
AGCATCACGGACGCCTGTCTGTCTGTGGTGGCTCAAACCT
TCATGGACTCCTGCTCCACATCTGAACACAGACTGGGCAA
GGATTCACCCTCTAATAAGCTGCTTTATGCTAAAGATATC
CCCAACTACAAGAACTGGGTAGAAAGGTACTACGCTGACA
TCAGCAGGCTGCCAGCCATCTCTGATCAAGACATGAATGC
GTATTTGGCGGAACAGGCCAGACTTCACTCCAGCGAGTTT
AACATGCTCAGTGCCCTCAACGAGATTTACTCCTACATTA
GCAAGTACAGCGAAGAGATCACAGCTGCACTGGATCAAGA
CGAGACGGCCAAGAAACAGCGATTGGCCTATAAAGTGGAG
CAGCTCATCGCCGCCATGTCGCTGGAGAGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations