ZFIN ID: ZDB-TSCRIPT-090929-22209
Transcript Name: zgc:171775-201
Previous Name: zgc:171775-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042502 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042502|OTTDARG00000030649|ZDB-GENE-030131-4309 zgc:171775|OTTDARP00000033790 CH211-188C24.2-001 LG_ CR352294.8 Danio rerio protein_coding KNOWN, 3962 bp
GGTCGAGCAGCGCGGTCACGGAAGCGGACACGCGGATCAG
GTGCACAGTCTGAAGGTGTTCATGGCTTCCCCTCTGAAAA
CGGGCTTCCACAGACTGGACATCCAGAAAACTACGTGGGA
TGTCCCTGACCGATACACCTCTCTCAAGCCTGTTGGGTCT
GGAGCTTATGGGACAGTGTGTTTTGCAGTCGACCAGAAGA
CCAAGGAAAAGGTGGCCATTAAAAAGCTGTACAGACCATT
CCAGTCTCTGATCCATGCTAAACGAGCCTATAGAGAACTC
CGGCTGCTGCGTCACATCCAGCATGACAATGTGATCTGCC
TGCTTAATGTCTTCACCCCTGATTCTTCGCTGGAGAAATT
TGATACGTTCTATATGGTGATGCCTTTTGTAGCTCAAGAT
CTTGGACACATAATGAAGAGGAAACAATTAACCAGCAATG
TCATCACTTACTTGTTCTATCAGATACTGCGAGGACTAAA
GTATATCCATTCTGCTGGGATCATTCATCGGGATCTTAAG
CCTAACAACCTTGCAGTGGATGAAAACTGTGAGTTAAAGA
TCCTGGACTTTGGACTGGCAAGACACACTGAAACTGAGAT
GACGGGCTACGTGGTGACACGCTGGTACAGAGCACCTGAA
GTCATCTTCAACTGGATGCATTACACTCAAACAGTCGATG
TTTGGTCTGCTGGCTGCATCCTGGCTGAGATGATAACAGG
AGAAGTGCTTTTCCCAGGCAGTGACAGTATTGACCAGCTG
AAGAAGATCCTCAATCTGACAGGGACACCAAACTCAACGC
TGGTTCTGAAAATGCAAAGCAAAGATGCGCAGTCGTATGT
CCGCTCTCTTCCAGTCCAAAAGAAAAAGGCCTTCAAAGAG
GTGTTTTCTGGAATGGATCCAAACGCCATCGATCTGTTGG
AAGGTATGCTGGTTTTGGACCCAGAGGTGAGACTTTCTGC
AAAAAATGGCCTTTCACATCCGTACCTCTCTGAGTTTCAT
GACCCTGAAAATGAGCCCGTGTCTCCTCCATATGATGATT
CCTTTGAGAGTATGGATCTGGCTGTCAGCGAATGGAAAAG
TCTTATCCACATGGAAATCATGACATTTGACCCCAACAAC
CCCAGAGTGACTGCAATGTAATACCTTATTTTCACATTGG
GAGAACAACACATACTCCAAACAGACTCTGGAAAACTGTC
TGCTTGCTAAGATGTGATATATTGGAAAAAACCCCAGCTC
CAAGTCATTTTTGTTGAGATTACTGTCACAACAACTATTT
TTAAGCAGTGTTTGTTAATATTACACATTTAGAAGAAGGC
TAAAGTGTAGAGTTTGACCGTTTTTGATACTACGCAGATT
CTAAATGGTGCTGCAAGAGTAGGGGTTGGTGAGGGGGACT
ATTTTCAGGTGCTGCATAATATCATTGTGCCTGCTTCAGC
CATGGTACTGCAGCAAAGTTCCTTGATTATTACGCCAGAA
TTAGATTGTATTTCTCAGCAAAATCAACCTAGAAAATAAC
AACTTATCATTTTTCGATGGCTTTTTTGTGGTCTCTATGT
ACATTTTATCTCCATGTATGTCATTTGTTTAGAATGAGAT
TTGGATATGTTGTTGCTTTTTTGATAGTATTACAACACAC
TGTGAGTATATATATATATATATATATATATATATATATA
TATATATATATATATATATATATATATATATATATATATA
TATATAGTACATCTTATCATTTTCCTTTGGATCTTATACA
GTAAAGTGTTTGATAAACTGTTTCACGGCATCAGACTTAA
TAAGCAGTTTACTTTTTACAGTTTTTCTGAATTGCTTTGG
CTCTAATTTTGATTGATATTTTTATTTTTCAAAACAGTAA
ATTTTAAATCTCTGCACAATTAGCTTATTGTTCACTTCAG
TGTGGCATTTCATATTGATTTAAGCAAATTGCAAATGCTT
TGGCACATGTGTGCAAACAAAAAAAAAATTTGCAAATGGC
TTGTTGATCAAAACTAATGAGCCAATTCTCATTTAAACTG
TCAAACTCTTCACAACTTCTCAATAATTTTTCATCGTTCA
TCGTCACACTCAAAACTATTTATTCAATTATCAAACATTT
GTATATGCACATAGGGCGACACAGTGGCGCAGTGGGTAGC
ACGTTCGCCTCACAGCAAGAAGCTCGCTGGGTTGCTGGTT
CGATCCTCGGCTCAGTTGGCGTTTCTGTGTGGAGTTTGCA
TGTCTCCCTGCGTTCGCATGGGTTTCCTCCGGTTTCCCCC
ACAGTCCAAAGACATGCAGTACAGGTGAATTGGGTAGGCT
AAATTATCTGTTGTGTATGAGTGTGTATGTGTGGATGTTT
CCCAGAGATGGGTTGCGGCGTGAAAACTTGCTTGATAAGT
TGGCGGTTCATTCTGCTGTGGCGACCCTAGATTAATAAAG
GGACTAAGCCAACGAGAAAATGAATGAATGAATGTATATG
CACATTGTTGGAATATCTAGTCAATTCCATGTTCAATAAA
AAAGGCAAAAAAAATCGTAGTAATTTATCGGATACAAATG
AATAATTTGATTCACAGATCGATTCTGTTATCCTCAATGT
AATGCAAAAGTTACATTCAGGAGGTGCATAGCAATTTTCA
TTTTCTGATTAGCGCATTTATAGTGAAATTCACTTGTCAA
TCATTCTCCAGTCCACCATTGGCTGCACCCATACATTCGT
CCTCTTTTTCTACGAATTCTCTGCACAACATTAAAAGCAT
AAGACTTTCTCAACTGCACATATTCTGTGTTCAGTTTCAA
CACATCTCTGCTTACAGGACATTCAGCTGCAGAGCTCAAG
TTAATTTTAGACAATTAGGTTTTTGCATTTCTATCAGTTT
CATCTATTTCTGCAAAAATGCTTCTTTAGTATGCAAAGCA
TATCACTCTCAACATAAGAAGTTCAGTTTATATATCACCT
TTAAACAACACAAATACAGTTAATGAAAAAAAGAGACAAA
AATCATTGAAAATATATTCCTTTTTTCACATAATATGTTT
ACACCATAAATTTTTGAGATTGACATTGTTTGTAATGTCT
GCTAAATTGGCAAATTACCTCTACTTGCAGTACCTTGCGT
TATCTATTTATCATATATGGTACAAAACTACTTATATGTA
TATATATTATAGGTGGGCATAGATTCATTTTTTAATCTAG
ATTAATCTCAGAATTAATCTATATTAATCTAGATTAAAAT
GGCTCATTTGAATTCTGCTGAAGGCATTCAGAATATGTGT
GCTACCCAAATAATAAGTCTTTGAGAACGGATTTCTCAAG
CCAGCATCACAGTGCATCACAATGTGATGCAAATACATTT
GATGTTTTGTTGGCCTTGGCCAAATTACTGACACATTAAC
TAGACTTTGAAGCATTTTTGGGTTTTAATTGAGTAACTAT
ATTTTGCAGACATTCAATAAAGGTCTGAAGGTCCAACAAA
CAGTTTTGATATTTGCACTCAGAGTTTAGAGAATGTTAAG
TCTGTTTTGAAAAATGTGCCAAAGCAATTGAGAAAAACTG
TAATCCAATGCCATTGGCTGGATAAAACATTTAAAGGGAT
AGTTTAACCCAGAATGAAAATTTGCTGTTAATTTACTCTC
CCTCAGATCACATCAAGATGTAAGTGACTTTTATTATAAT
TTTTTAAAATTATAATTTTATTTAGCTCAAACTGTTCTCC
ATGATAATTCGTAAAAAGCATATTGTTATTTTGAAGTGTG
ACCACTACCCCTAAATTAACAGCAACTTTTCATTCAATTT
TATCACATTTTCATCATTAAGTAATGTTAACTAGCTATCT
TCAAAGAAAGATGTTATATACCATGTAAACGTGTGAAACT
TGTCTGTTTGTTAACCAACTTTTTAAAAGAATTTTAAAGC
ATAAATATTTGAATGTAATAAAATGAAGTTTTGTGTTCAT
AA

zgc:171775 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript zgc:171775-202 (1)    Ensembl 534
mRNA zgc:171775-201 3962
ncRNA zgc:171775-003 (1)    Ensembl 452
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:171775-201 Contained in:
[BAC] CH211-188C24 (1)

Genome Resources: Vega_Trans:OTTDART00000042502 (1),  Ensembl_Trans:ENSDART00000048073 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154001 (1) 1825 nt
GenBank:AI965312 (1) 492 nt
CITATIONS (2)