Transcript

tmprss12-201

ID
ZDB-TSCRIPT-090929-22034
Name
tmprss12-201
Previous Names
  • tmprss12-001
  • si:dkey-9p24.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042301 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042301|OTTDARG00000030531|ZDB-GENE-090313-370 tmprss12|OTTDARP00000033653 DKEY-9P24.4-001 LG_ CR376824.10 Danio rerio protein_coding NOVEL, 857 bp
GTTGAATCAAATGATTCGTTTCTGCCTGCTTCTATCTCGC
TGTTTTTTGTTGCTTTCTCGTTTAAAATGAGCCTAACATT
CGTCTTAATTATAATTTGTCTGTTACCCTTTGGGATTGCA
GGTTGTGGACAGCGAACTTTGGTGAGCCCGCCAAAACAGT
CCCGAATTTCAGGGGGCCACTCTGCATTAGAGGGTGCTTG
GCCTTGGCAGGTGAGCATTCAGCAGATGTTCTGGCATATT
TGTGGTGGGTCCATCATCAGCCACCGATGGGTAATCACCG
CATCTCACTGCTTCAAGAAAAAAAGAAACAACAATAAACT
TCTAGTAGTGGCTGGAGTGAATTCACGATTCAAGCCAGGA
AAAGAAGTGCAGTATCGCACTGTCCAGAAAGTCATCCTGC
ATGAGAAGTACAACCAATCCGAATATGACAACGATGTGGC
ACTGTTGTATCTGCACCACCCTTTCTATTTCACAAATTAC
GTGCAGCCGGTGTGCATACTGGAAAATCAAATGCATGAGA
AACAACTCAACTTTGGGTTATGTTACATCACTGGATGGGG
CAGTTCAGTGTTAGAAGGAAAGTTATACAACACTCTCCAG
GAAGCTGAAGTTGAGCTCATTGACACTCAAATCTGCAACC
AGAGATGGTGGCATAATGGCCATGTTAATGACAACATGAT
CTGTGCAGGATTTGAAACAGGGGGAGTCGACACCTGTCAG
GGTGACAGCGGAGGCCCTCTGCAGTGTTACAGCCAAGACA
AGGAGAGATTTTACCTTTTTGGTGTGACAAGTCATGGAGA
TGGTTGTGCTTTGCCAAAGAAACCTGGCATATATGCTCGT
GCAAGTCGTTACACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations