Transcript

si:dkey-21c19.3-201

ID
ZDB-TSCRIPT-090929-21980
Name
si:dkey-21c19.3-201
Previous Names
  • si:dkey-21c19.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042246 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042246|OTTDARG00000030497|ZDB-GENE-030131-6462 si:dkey-21c19.3|OTTDARP00000033618 DKEY-21C19.3-001 LG_ BX005414.13 Danio rerio protein_coding KNOWN, 3036 bp
GGAAGAAGCGGGAGGCGTTAATGAAACTTTGTGTACTCAA
CATCTCATTCACGGAATCACCTGCTGTTTCTGAGAAAGTC
GAGTCCGTTAGAAAAAGATAGCTACAACTGATACTAACAC
TCGCGGGCAGCTCGCCGGAGCTCGTTAAGCACAGTTATAT
TTAAAGCTGAGCTGTTTTCTCGCGTGTTAGCTGTTGGTTA
GCTGGTTGAGCTAAAGATCAGCGCTGTGGGTTTATCTGGA
CTGGTTTAGTCGTGTTCACCTAGAGGATTCAGCTACTTTT
ATCTCAACAAAGCTGGTTAGCAGTGGCGTGCGGATGAAGG
GCAGGGGGAGCCCGCGTTTGGGACTGCGCTGACAGCCCTG
AGGATTTATCCTGCTCATAATCGAGGCTTTCAACATGTTT
AATAAGATCTACGAATGGTTTGGAACCGGCTTCGCTAGTC
TCAGAAATGGAGCTCCTGCCGGTGCAGTCAATGCTGATGC
CGCGAGAGTGGATCAGGACGGGACGTCACGGAGAAAAAGA
TCCATAAACTGTTTAAATGATGGAGACCAGGAGGAGGAGA
GAGTGGTGAAGAAATTCAGAATGGGAGATATTATGGATAC
GGTGAAAAATGCAGCTGAAGGAGTAAAGACCCATGGTTCA
AATGTTGCATTTTGGGTTAAGAACAGTGTGAGTGCTAATT
CGAGGAACATGCTGCCGACATCACCAGGTCCTCCTCAGTC
AGGAATACCATCAGGACCTGCAGCCAATTCTACATCTACA
TCTTTGTGGACAGAAGACAAGCCACATGACAGACTTCAGG
ACACATTTGTGGCCCCATCTAGTTCAGTTGAGTGGAGGAC
AGTCACAAAATCTGACTCCTTAAGGACTGAGCACTCAGTG
ACCATATCAAAAACAAGCAGAAGACAAGTTTGTATGGAAC
ATCCACCCCATGAGATGTACAAAGCTAATGGACACTCTGT
AAATTTACCATCTTCCTCCACGCCAAAACCATCCCCATCT
CCACGCTTGGGCAGGTCCCTTTATCACCGACCACAAAGCA
TACTGTCATCGCCTGAAACCAGTTCAGGAAAAGCCACGTA
CACCAGCCTGTATGAGAAGACCTTTCCCATTCGAGTGGTC
CAGAGTTCTTTACCTGGCAGCTCAAACCGTCTTCTCCGGG
CCAGAGCCCGCTCTACAGCACAAGAGTCAGTACGTGAGGA
GGAAAAGGAGGTTTACAGGCAGCTGCTAGTCATGGTGTCT
GAAGGCCAGTCTTCTTTCCTTCATGATGGAAGTTCTCACT
CCAGCATTCGCTCGCATCGAGATTTCTCCAGCTTTCTGTC
GTCCAGTCGAAGTCTCCTTCATTGTGCCTCTCCAGCAGGC
TCTGGTGCTGGTGTTTCATCCTATGGGTTGTCCAGTCCAC
CACCGAGTCCCCAGCCTGGCTCAAGCCAGACCTCCAGTGC
TCTGCCCAGTCCTGGTGCAGCCTCCAGCCTAGCAGAGCCT
CCGCTTTGGGCCCATGACCTTGAGCCCAGTGCTAAAGGAC
CAGATGTTCCCTCCGCTCCTTCTCCAGCGGCTCTTCAGGA
TACCTCTTCTCAGGACACTCAGTCTTCAGCTCATGATGGA
GATTCAGTCATTTTCGTGAAGGAGCAGCAGGGAAAGAAGC
CAGAGAGCTCAAGTGTGCCATGCTTCCAGGCTGAATTGTG
GATCAAAGAATTGACAAGCCTCTATGACTCTCGAGCTCGG
GAGAGACGGAGGTTGATTGAAGAACAGGAGGCTCTGGCCT
CTCAGCTTCTACGCCAGCGCCTCTCTGGAGAAGGTCGAGC
TTCCCCAGCAAGTGTTGAGCTGAAAGTTCGGGTTCCACTA
GAAAAGGAGGTTCCTATTGCTGCTGTTATCAAAAAACCTC
AGCCAATTAAGGAGGAGCCTGAATTCCCAGAGTTAACAGA
GGAAATGGAGAACGATGTGAGCAGAGCTCTCAGAGGTGGC
AGTCAGGACGAGATTCTCAGCGAGGGCTTCCGACTCACCA
TCACCAGGAAAGACCTGCAGACACTCAGCCATCTCAACTG
GCTCAATGACGAGGTTATAAATTTCTACATGAACTTGCTG
GTGGAGCGCAGTAAACAGCCCGATCTGCCATCCGCTTACA
CCTTCAACACCTTTTTCTTTCCCAAGCTGCGGAGCTCTGG
TTACTCTGCTGTCCGCCGCTGGACCAAGAAAGTGGATATT
TTTTCTGTAGACCTCATTCTGGTGCCTGTCCACCTGGGGG
TGCACTGGTGCTTGTCTGTGGTGGATTTCCGTAACAAAAG
CATCACTTACTTTGATTCCATGGGAGGAAACAACGATGAG
GCCTGCAGGATTTTATTAAATTATCTGAAACAAGAAAGTG
AAGACAAAAAAGGACAAAAAATGGAAACCTCAGGATGGAG
CCTAAAAAGTAAAAGACCCAACGAGATCCCTCAGCAAATG
AATGGAAGTGACTGTGGAATGTTCACATGCAAATATGCTG
AATACATCACCAAAGACCGGTCAATCACATTCACACAGAA
ACACATGCCCTATTTCAGAAAGCGAATGGTATGGGAGATC
CTGAACAGGAAACTGTTGCGATAGGATTTTTTTTTTTTTT
TTTTGTACAGAACATATTTTTGTGTTGTATTGATATGAGA
GATACCCAAGACGAATATGAGGTGCACTCATTCACTGGTC
ATTTCTATGCTATCTGAATGAAGTTCTCATAAACCTAAAG
GACAGTTTCAGTCTTTAAGAGTCAGGGCAGTGCTTTTATG
CTCCTTTATATTTCCTTATAACTTGACGTGGATTTGCTCA
GCCAGCGAATGTTGTTTGACTGACAATGGAAGGATGCTGT
TTTCATATTTTTAATCTTTTCTTGTCCTGCCATTCATTTG
CATTCTCTGTCAATTTGAGGCCTGTCTTAAGATGACTACA
AACAATTACTGTTGGTTGGCAGGACTTAATTTCCAATCAT
CTGAAGTCTTAAATGTTACAGTAATATGATTACTGATTTT
TAATGCCGATATCTTTTTACTCCGGTACTTGTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations