Transcript

nckap5l-201

ID
ZDB-TSCRIPT-090929-21919
Name
nckap5l-201
Previous Names
  • nckap5l-001
  • si:dkey-31b16.13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042181 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042181|OTTDARG00000030455|ZDB-GENE-090313-304 nckap5l|OTTDARP00000033579 DKEY-31B16.13-001 LG_ BX957326.8 Danio rerio protein_coding NOVEL, 4615 bp
GACGGATGGGAAGAGACGACGATAAAACCTCTAATCAGCG
GCTGGGAAGACAGATAAACATGTCCACAAGCTGTGAATTC
AATAGTACAGTGCAAGGTATTTCTTAGCGATACTCATCGG
GGATATTTTCACACCTTCTGAAGAAACGCAAGGATCGCGC
GAGGTTGAGACAATGTCGGAAGAGGCTCAAAATAGAGTAG
ATGAGGACTTTGAGTCTGAGGAGGGTGATTTGGAGTCCTA
TCTAGAGGAAGAGAGTAGCAGTGAGCTTCTGGAGCGAGTG
AGAGAACTTCAAGCAGAGAACTCTGCCCTTTCATTAGCAA
ACGAGAGTCAGAGAGAAGCATATGAACGATGCTTGGATGA
GGTGGCCAACCATGTTGTCCAGGCTTTACTCAATCAAAAG
GATCTCAGAGAGGAATGCATCAAACTGAAAATGCGTGTTT
TTGATTTGGAGAGGCAGAACAGAACACTGTGTGAGCTTCT
GCAGGAGAAACTGCACAGTCAGTCTTGTGTACATCAGCAG
CCAGGACCCTGTCTGGAGCACATTGGTGAGCTACAGCAGA
GTGAATCTACCAAACTGATTGAGGCTCAAAGGAATGCACA
GGCCAAGGGTAACAGCGAATGTGCACAAAATTCCGTACCC
GAGACTCAAGGCTCGTCCACATCCATGGAGGCCATGTCCC
CATTCTTGAAGAAGAAAGCACACATTTTGGAGGTTCTCCG
CAAACTTGAAGAAACAGATCCACTTCGGTACCATCGTTCC
TCTGGCATTCCCTCCATCTGTGACTACAGTCAGGCTCTTG
CCTCTAAGGAGGCTGTATTAGCCTGCAGAGACAATACATC
CAGGTGCAATGCACCCAAAGCACATTGTTCCCATTCCTGT
CCAGATGTTTGCACACATCAGCATTTGAATGGAGGAGAGC
ACAGCAATGTAAAGTGTGGTAGTTGTAGCACATGTTTGAT
GCTGTCCAATAAAGATTCCGTCAGCTTAGCCAAGAGTAGC
CACAACTGTTGCACTTCAACCCCCATTACCATTGATAACC
TCAATTTGGCTCGGCCCGATTTCCAAGAGAATGTGGAAAT
GCAGAGCCTTGTGAAACCTGCCACAGGTACAAGTGAACTG
TTTGTAAACAGGACTTCTGGAGATATGTCGATTCTTTCAG
CAGAGCAAGGTCTTATACCGTCAGTTGATCCTCACTCATT
AGAAGCCCCTGAATCATACTCAAGATTGACTATTTCAGAA
AGAGATCAGCCAAGGGGAGTCTCTGACCATGTGTTGGTAG
ATACAAGAGAAAAGAATAGGTTGTCTGATCTTCTCCTTGA
GTGTCAATCCAACAGGTCAAGCAGCAGCACCTGTAATGAG
ACTATTTGTGACGATGGCACAATTGATGTGGTGCTGCTAG
ACTCAGATTTAAAGCACTTAAATGCTATAGCACCTCAAAG
GCTTGATAAAGAAGAGTTTGCGACAAAGGATGACTCTGAC
TGTGTCTATCGAGCCAACATAGCCTCCTCAAAGCTGCCTA
CTCTTGGACTAAAAGACACACACTGTGAGATTGACAGCAG
CGAACAGGTCCACAAAGGTCTGTTATTTTCTCCCAATGAG
AATCATACTGCCTCAAAAGTACTGGATGACATCTCTGTAC
CTGTAAAAGATACCCCATCTGACCCTCAGTCCATTAGATC
GAAAGTTGCAGTCAGCCCGAGTCAAGTTTCCTGCCTTAGA
GAGGTCAAGGCCTCACCCTCCAAACTGCTCAAGTTCCTTA
AGATCCCCACTATTGGAGAACGTACTGCAGTACCTCCACC
TCGTCTCAGTCCTCAGTTGACAAGAAGCTCAAAGATTCCT
TGCCGGAGCAACAACTATGAGGTGCACAGTTCACCTGTAG
CCACACGAAAAGCCACCACGACTGAGAGGCAAAGACAGGT
GACCCCTCCAAAATCAGAGTCACACTCTGCTCCAACTTCT
CCACCCCAACCTGATGATGTCCCCACACCTTTGCCAAAGG
ATCTTGGTTGTGGTATCCCTAAAACAAGTCGTGTAGCTAA
GCCTACACAAAGTACTCACAATCAGAAAACCCCTCAGAAA
ATTCCACACTACGAAAATGTCTCAGATATCTCCAAAACGA
GCAACACTGATGTATCCCAGCTGCTTGGAGAAGTGAGCTC
ATCTCTTCAAAATTCCAGCCCTGCTAATGAAGGTGCAAAA
GGAAAGCAGACAAAGTTTGGTGTAGAGAGACCAACGAGTC
TTAAGCATAAGGAGATCTCACCAGAGTCAGATTCTTCAGA
CCAAGAGGACAGCTCGGAGAGCCCAGTGTGGCATAAGCAA
GTCAATCATCGCAGTCTGCCCAGTCAGTCATCATCCCAGA
AGGCTCAGACTGGGATTAGCACTAGATCAAGGAGCCAAGA
GAAAAATGAAATGGCAGACAATGATTCACAGAGCTCAGAA
TCACCTTTTAAAAGGAGCGATCCACCGCCTGTTCCTAAGA
AATCAGGGATTGGAAGACATTCAGGTGAGTCAAGTCATTC
CTTTAAAGAACGACTGGCTGCACTTGGCAAGTTGAGGAAC
CCAGATGAGTCTGCAGCATGTCCTCCACTTGCAGAGAAGA
AAGAAATCCAGTCTGCTGCAAGCATACCAACAAGAACCAC
AGATAAAAGCAAAACTGCTGACAGAAACTCTGATTGCAAG
TCAGGGGAGTATAGACTTCCTAAAAACACAGATTCAATTG
AGGACAAATCATACCATTCAGGTCATTATGATGGTGCTGT
TTCAAAACAACCGGGAGCCTTCCAGCATGTTGAGCAAACT
GTCAGGTCTCTTCCGTCCAACACGTTAATCTCCAAACTTG
AACACGAATCCCCTAGAACATTCATAGCCAAGCAAGAGAG
CCCGAAATCTAAGATGCACCAACCGTCTGCTAACCTAGAA
GCAGCACAGGCTTTGCGTAGCTATGCTAAGAGTACAACTC
CCCATAGCCTTTCATATAACGGAAAAAATGTTGCTAGTCC
CCATAGTAGCAGCCCCAATAAAATCCCTCTCAAGTCACCA
ACTAAAACTGTGCCACCCTCTATGAACCGAGAAGGGAAAC
CTACTCCAGAGTTTCAAAGGTACATGTCCAAATCTGAAGA
CAGGAGCCATCTCAGGGCCAATAAAAAGAAGAATTCTTCC
TATGGAGAGAGTCTTCCTCCGCCGCCACCAAGGCCGGTAG
AGGCCGTTGAAGAAAAGAGGCACTCGGCCCCCAGTCCTCA
GTCTTCTATTGAGCAAAAGGTCATGAAGGGCATTGAGGAA
AATGTGCTGAAGCTGCAAGAGCAAGACAAAGGTCAGGTGG
TCGAGGTCAAGCAAAAGGCTTCCAATGGAATCGCCAACTG
GTTTGGTCTCAGAAAAAGCAAGCTTCCAGCTCTTAGCCGT
AAACCAGAAACCTCGAAAGTGAAAGATGACAAGAGAGAAT
GGAAACTCAATATATCCAAGGATTCCAAGGGGGCTGCGAA
GAAACCTGAGAGTGAGAGCCTAAACATTTCAATGCTGATT
GAGAAGGCAGAGGGCTTGCATAAAGCTCTTGAAGAAGAAC
GGGCTTATGTGAATGGAGTGGCGTTGGACCGTCAAGGAAA
GGGACATTCATGTGAGGTAGTGATGGACCAAGCCCAAGGT
CAGCTGTCTGTGATGTATAGAGGAGTGCCATCTGACAACT
TCATGCAGCAACTTCTGAACCGGGTTGATGGGAAGGATAC
TAGTGGCATCAGTATGGCACATAGACGTCTCTCATTTGAC
TGTAAATCCAGACCTGTTTTTAGTCACCAGAGTGCTGCCA
TTGCTAGTCAGACACGAAGCAGTGATGACATGGAAAAGGT
CTCTGCATTACTAAGTAAAGACGTCACGTCGGACGACAAC
CTGGCTGAGACAATTCATCATGAACACTTTGCAGGATCTG
GAATCTCCACACACACTCTTGACAGCGGCATCGGCACCTT
CCCTCTTCCAGACTACAGTGCAAACGCTGGTTGTAAAAGC
ATCCCAAAAGGAAAGGCCCACGGGGAGAGTGACCCTTCTC
ATCTCCAGCCCAAACACGCATCAGGGATGAAGATGTCCCA
CAAAGCCTGGAGCCTGGAGAGAGAGTTGTCATCATTAGAG
GAGGATTATATGGGCGGTCAGGACATGGACCACCACACCA
GCACTATAGAAAACAAGATTCCCTCCAGCCAGATTGCAAA
CATAGTTCATGATGGCACTGATATCTGTGGAGCCCCTATG
AAATTAGGCCCCACAAAGAACTGGACTTTCCCAAACCTCA
AAGCATCTGCGGAGTCAACTGAGGTTTATCTGGGTGTTGG
AGACGCAGTGGAGCCGGTGACTCACAAGAGTTCATTTAAG
AGGCGCAACAAGACTAGTGATTCAGTGGCCAGTCGTGAGG
GAGATCCAAGAAGTCTTCCTCAGCCCAGTCAGACACGCAG
AGTCAAGAGCCGCATTCCTGGAAACCCTGAGCTGGTGCGG
GACACTGGTCTGGAGCTGGTAAGAGAGCGACCCGACGACG
GCCTGTCCCCAAACCACCCGCAGGTCCTAGAGACGCCCGA
GTCTCTGAGCGATTCCCTCTACGACAGCCTGTCCTCGTGT
GGCAGTCAAGGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations