ZFIN ID: ZDB-TSCRIPT-090929-21919
Transcript Name: nckap5l-201
Previous Names: nckap5l-001, si:dkey-31b16.13-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042181 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042181|OTTDARG00000030455|ZDB-GENE-090313-304 nckap5l|OTTDARP00000033579 DKEY-31B16.13-001 LG_ BX957326.8 Danio rerio protein_coding NOVEL, 4615 bp
GACGGATGGGAAGAGACGACGATAAAACCTCTAATCAGCG
GCTGGGAAGACAGATAAACATGTCCACAAGCTGTGAATTC
AATAGTACAGTGCAAGGTATTTCTTAGCGATACTCATCGG
GGATATTTTCACACCTTCTGAAGAAACGCAAGGATCGCGC
GAGGTTGAGACAATGTCGGAAGAGGCTCAAAATAGAGTAG
ATGAGGACTTTGAGTCTGAGGAGGGTGATTTGGAGTCCTA
TCTAGAGGAAGAGAGTAGCAGTGAGCTTCTGGAGCGAGTG
AGAGAACTTCAAGCAGAGAACTCTGCCCTTTCATTAGCAA
ACGAGAGTCAGAGAGAAGCATATGAACGATGCTTGGATGA
GGTGGCCAACCATGTTGTCCAGGCTTTACTCAATCAAAAG
GATCTCAGAGAGGAATGCATCAAACTGAAAATGCGTGTTT
TTGATTTGGAGAGGCAGAACAGAACACTGTGTGAGCTTCT
GCAGGAGAAACTGCACAGTCAGTCTTGTGTACATCAGCAG
CCAGGACCCTGTCTGGAGCACATTGGTGAGCTACAGCAGA
GTGAATCTACCAAACTGATTGAGGCTCAAAGGAATGCACA
GGCCAAGGGTAACAGCGAATGTGCACAAAATTCCGTACCC
GAGACTCAAGGCTCGTCCACATCCATGGAGGCCATGTCCC
CATTCTTGAAGAAGAAAGCACACATTTTGGAGGTTCTCCG
CAAACTTGAAGAAACAGATCCACTTCGGTACCATCGTTCC
TCTGGCATTCCCTCCATCTGTGACTACAGTCAGGCTCTTG
CCTCTAAGGAGGCTGTATTAGCCTGCAGAGACAATACATC
CAGGTGCAATGCACCCAAAGCACATTGTTCCCATTCCTGT
CCAGATGTTTGCACACATCAGCATTTGAATGGAGGAGAGC
ACAGCAATGTAAAGTGTGGTAGTTGTAGCACATGTTTGAT
GCTGTCCAATAAAGATTCCGTCAGCTTAGCCAAGAGTAGC
CACAACTGTTGCACTTCAACCCCCATTACCATTGATAACC
TCAATTTGGCTCGGCCCGATTTCCAAGAGAATGTGGAAAT
GCAGAGCCTTGTGAAACCTGCCACAGGTACAAGTGAACTG
TTTGTAAACAGGACTTCTGGAGATATGTCGATTCTTTCAG
CAGAGCAAGGTCTTATACCGTCAGTTGATCCTCACTCATT
AGAAGCCCCTGAATCATACTCAAGATTGACTATTTCAGAA
AGAGATCAGCCAAGGGGAGTCTCTGACCATGTGTTGGTAG
ATACAAGAGAAAAGAATAGGTTGTCTGATCTTCTCCTTGA
GTGTCAATCCAACAGGTCAAGCAGCAGCACCTGTAATGAG
ACTATTTGTGACGATGGCACAATTGATGTGGTGCTGCTAG
ACTCAGATTTAAAGCACTTAAATGCTATAGCACCTCAAAG
GCTTGATAAAGAAGAGTTTGCGACAAAGGATGACTCTGAC
TGTGTCTATCGAGCCAACATAGCCTCCTCAAAGCTGCCTA
CTCTTGGACTAAAAGACACACACTGTGAGATTGACAGCAG
CGAACAGGTCCACAAAGGTCTGTTATTTTCTCCCAATGAG
AATCATACTGCCTCAAAAGTACTGGATGACATCTCTGTAC
CTGTAAAAGATACCCCATCTGACCCTCAGTCCATTAGATC
GAAAGTTGCAGTCAGCCCGAGTCAAGTTTCCTGCCTTAGA
GAGGTCAAGGCCTCACCCTCCAAACTGCTCAAGTTCCTTA
AGATCCCCACTATTGGAGAACGTACTGCAGTACCTCCACC
TCGTCTCAGTCCTCAGTTGACAAGAAGCTCAAAGATTCCT
TGCCGGAGCAACAACTATGAGGTGCACAGTTCACCTGTAG
CCACACGAAAAGCCACCACGACTGAGAGGCAAAGACAGGT
GACCCCTCCAAAATCAGAGTCACACTCTGCTCCAACTTCT
CCACCCCAACCTGATGATGTCCCCACACCTTTGCCAAAGG
ATCTTGGTTGTGGTATCCCTAAAACAAGTCGTGTAGCTAA
GCCTACACAAAGTACTCACAATCAGAAAACCCCTCAGAAA
ATTCCACACTACGAAAATGTCTCAGATATCTCCAAAACGA
GCAACACTGATGTATCCCAGCTGCTTGGAGAAGTGAGCTC
ATCTCTTCAAAATTCCAGCCCTGCTAATGAAGGTGCAAAA
GGAAAGCAGACAAAGTTTGGTGTAGAGAGACCAACGAGTC
TTAAGCATAAGGAGATCTCACCAGAGTCAGATTCTTCAGA
CCAAGAGGACAGCTCGGAGAGCCCAGTGTGGCATAAGCAA
GTCAATCATCGCAGTCTGCCCAGTCAGTCATCATCCCAGA
AGGCTCAGACTGGGATTAGCACTAGATCAAGGAGCCAAGA
GAAAAATGAAATGGCAGACAATGATTCACAGAGCTCAGAA
TCACCTTTTAAAAGGAGCGATCCACCGCCTGTTCCTAAGA
AATCAGGGATTGGAAGACATTCAGGTGAGTCAAGTCATTC
CTTTAAAGAACGACTGGCTGCACTTGGCAAGTTGAGGAAC
CCAGATGAGTCTGCAGCATGTCCTCCACTTGCAGAGAAGA
AAGAAATCCAGTCTGCTGCAAGCATACCAACAAGAACCAC
AGATAAAAGCAAAACTGCTGACAGAAACTCTGATTGCAAG
TCAGGGGAGTATAGACTTCCTAAAAACACAGATTCAATTG
AGGACAAATCATACCATTCAGGTCATTATGATGGTGCTGT
TTCAAAACAACCGGGAGCCTTCCAGCATGTTGAGCAAACT
GTCAGGTCTCTTCCGTCCAACACGTTAATCTCCAAACTTG
AACACGAATCCCCTAGAACATTCATAGCCAAGCAAGAGAG
CCCGAAATCTAAGATGCACCAACCGTCTGCTAACCTAGAA
GCAGCACAGGCTTTGCGTAGCTATGCTAAGAGTACAACTC
CCCATAGCCTTTCATATAACGGAAAAAATGTTGCTAGTCC
CCATAGTAGCAGCCCCAATAAAATCCCTCTCAAGTCACCA
ACTAAAACTGTGCCACCCTCTATGAACCGAGAAGGGAAAC
CTACTCCAGAGTTTCAAAGGTACATGTCCAAATCTGAAGA
CAGGAGCCATCTCAGGGCCAATAAAAAGAAGAATTCTTCC
TATGGAGAGAGTCTTCCTCCGCCGCCACCAAGGCCGGTAG
AGGCCGTTGAAGAAAAGAGGCACTCGGCCCCCAGTCCTCA
GTCTTCTATTGAGCAAAAGGTCATGAAGGGCATTGAGGAA
AATGTGCTGAAGCTGCAAGAGCAAGACAAAGGTCAGGTGG
TCGAGGTCAAGCAAAAGGCTTCCAATGGAATCGCCAACTG
GTTTGGTCTCAGAAAAAGCAAGCTTCCAGCTCTTAGCCGT
AAACCAGAAACCTCGAAAGTGAAAGATGACAAGAGAGAAT
GGAAACTCAATATATCCAAGGATTCCAAGGGGGCTGCGAA
GAAACCTGAGAGTGAGAGCCTAAACATTTCAATGCTGATT
GAGAAGGCAGAGGGCTTGCATAAAGCTCTTGAAGAAGAAC
GGGCTTATGTGAATGGAGTGGCGTTGGACCGTCAAGGAAA
GGGACATTCATGTGAGGTAGTGATGGACCAAGCCCAAGGT
CAGCTGTCTGTGATGTATAGAGGAGTGCCATCTGACAACT
TCATGCAGCAACTTCTGAACCGGGTTGATGGGAAGGATAC
TAGTGGCATCAGTATGGCACATAGACGTCTCTCATTTGAC
TGTAAATCCAGACCTGTTTTTAGTCACCAGAGTGCTGCCA
TTGCTAGTCAGACACGAAGCAGTGATGACATGGAAAAGGT
CTCTGCATTACTAAGTAAAGACGTCACGTCGGACGACAAC
CTGGCTGAGACAATTCATCATGAACACTTTGCAGGATCTG
GAATCTCCACACACACTCTTGACAGCGGCATCGGCACCTT
CCCTCTTCCAGACTACAGTGCAAACGCTGGTTGTAAAAGC
ATCCCAAAAGGAAAGGCCCACGGGGAGAGTGACCCTTCTC
ATCTCCAGCCCAAACACGCATCAGGGATGAAGATGTCCCA
CAAAGCCTGGAGCCTGGAGAGAGAGTTGTCATCATTAGAG
GAGGATTATATGGGCGGTCAGGACATGGACCACCACACCA
GCACTATAGAAAACAAGATTCCCTCCAGCCAGATTGCAAA
CATAGTTCATGATGGCACTGATATCTGTGGAGCCCCTATG
AAATTAGGCCCCACAAAGAACTGGACTTTCCCAAACCTCA
AAGCATCTGCGGAGTCAACTGAGGTTTATCTGGGTGTTGG
AGACGCAGTGGAGCCGGTGACTCACAAGAGTTCATTTAAG
AGGCGCAACAAGACTAGTGATTCAGTGGCCAGTCGTGAGG
GAGATCCAAGAAGTCTTCCTCAGCCCAGTCAGACACGCAG
AGTCAAGAGCCGCATTCCTGGAAACCCTGAGCTGGTGCGG
GACACTGGTCTGGAGCTGGTAAGAGAGCGACCCGACGACG
GCCTGTCCCCAAACCACCCGCAGGTCCTAGAGACGCCCGA
GTCTCTGAGCGATTCCCTCTACGACAGCCTGTCCTCGTGT
GGCAGTCAAGGCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nckap5l-201 Contained in:
[BAC] DKEY-31B16 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000042181 (1),  Ensembl_Trans:ENSDART00000134978 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI891902 (1) 698 nt
GenBank:AL916766 (1) 436 nt
GenBank:EB894918 (1) 374 nt
CITATIONS (2)