Transcript

uhrf1bp1-202

ID
ZDB-TSCRIPT-090929-21821
Name
uhrf1bp1-202
Previous Names
  • uhrf1bp1-001
  • ottdart00000042075
  • si:ch73-90n13.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042075 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042075|OTTDARG00000030388|ZDB-GENE-090312-82 uhrf1bp1|OTTDARP00000033504 CH73-90N13.2-001 LG_ CU469313.15 Danio rerio protein_coding NOVEL, 4339 bp
CCGGTCATCATCATCTGCAGAAGAGACAGTCGTGAGCGGT
GTGTGTGTTTGTGTGAGTGTGTGTTTGTGTGCGTGCGTGA
GAGTGTGTGTGTCAGCGAAAGATTTCTGAAGATGCTGGAG
AACAGGAGGCTCATCTGACGGGATGGCGGGAATAATTAAG
AAGCAGATCCTGAAGCATCTGTCCCGGTTCACAAAGAACC
TCTCTCCAGATAAGATTAACCTGAGCACGCTGAAGGGAGA
AGGTCAGCTCTCCAACCTGGAGCTAGATGAGGAGGTACTG
CAGAACATGCTGGAGCTGCCCACCTGGCTGGCTGTCACAC
GCGTCTACTGCAATAAAGCTGCTATACGGATACAATGGAC
AAAGTTGAAGACCAGTCCCATATGCTTGTTCCTGGATAAA
GTGGAGGTTGAAATGAGGACGTGTGAGGAGCCCAGAGCCC
CAAACGGACCCTCTCCAATTGCAATTACTGCAGGTCAAAG
TGAGTATGGGTTCGCAGAGAAGGTAGTGGAGGGGATGTCT
GTGATCATCAACTCCATCACCATTAAAGTGCAGTCGCGAG
CGTTTCACGCCTCCTTCCAGCTCTGGCAGCTTCAGGGCTG
CAGCCTCAACCCCAAATGGCAGAAGAGCGACCTGCGGTAC
ACACGCGTCACACACCCCAAACGAGGAGAGGTGCTGACGT
TCAAGGAGATTAACTGGCAGAGTCTGCGTATCGAGGCGGA
CGCCATAGAGAGCGAGGATCAGGATCTGGGCAGCACACCA
CTACGACTCATTACTAACCAAGGCAGAATACGCATCGCTC
TCAAACGCAGGGTGAAGGACTGTAACGTGTTGGCCTCTAA
GCTGCTGTTTATTCTGGATGATCTGCTGTGGGTGCTGACA
GACTCCCAGCTCAAGGCAATCATCCGCTACGCCAAATCTC
TGAGCGAGGCCATGGAGAAATCTGGACAGCAGAGGAAGAG
CATGGCTGCGGACACACTGCAGACTGCTCCTCCCTCTCCC
AGCACACACTCTCTGTGGACGGATGCTCCTGCTCCTCCTG
AGGCGTCCGGCTCCTGCACTCTGGCTCAGTATTTCGATCT
GCATGATGTGAAGGAATCCTCCTACCACACCTTCATCTCC
CGCCTCGACCTGCACATCTGCAACGACAGCTCTTCAGAGG
CCGATGAAGCTCCTCTTCCAGGCACACAGGGTGCAATGCA
GCTGACCTTCAGGAAACTGGGCTTTGACTATTACCCGTTT
CACAGGCCAGGTGATGGCTGTCAGCACTGGGAACGTCACT
GTGGGGCGATGGACTCTCGGGCTCAGTGGGCATCAAAACT
TCTGCAGGACTTCCAGAGGAGGATGGAGGATCTGGGCATC
CCTGGACCTCAGTCAGAAGCAAATGTGTCAGCTAAAGACT
CTCCAGCCAGAAAAATTAAGGACAGGGAATCACAGTCCAG
TTTCAGCCCCGAGCGGACTCAGGCATCCGCCCTGAAGAAG
CTGCGCTCCAGCTGTATGGTGATCCGTGTGGACGATCTGG
ACATCCATCAGGTGTCCACTGGAGGCCGACACAGCAGGAA
AACACAGTCTCTTCTGTCCTGCAACCGCAAATCCCTCCAT
CTCCCAGAAAACACTCCTGCAATCCACCTTCAGTTCACCG
AATACTACTTTCCTGACATCCCTGGACTTCCAGTGCCCTC
CTCTAACCTGTATGCGCAGCTCAATGGTCTACAGCTGTGT
GTGGACGCTCCGAGCGTCTTATGGATGACTCTGTTTTCAC
GAGGTTTACACAGGACTTTAGATCAGGTCAAAGCTTTTTA
CCACCTGCAGGACAGCAGCAAGACTGACGAACACATCGAT
ATACGCCTGGATGCAACACAGCTGAAGCTGATCGTTCCCC
TGGAGTCCTCTATTTTGGATCACCCTGACCGTCCTCAGTC
ACTGAGCATCAGTTTTCCTCAGATAATCCTCAGCAACACG
CGTCAGTCTCCGCACGGCGCCCATTCGGACCTCAACAGCA
CCTACAGCAGCTTCTCCAGCCGTTCATTCTTCAATACCAC
ACAATGTAAACCTTTCCCGCGAGATCAGAGCGTCCTACAC
CCCCTGCCATCCGCATTTCTTCAACACTCCCTAGAAAACG
AGTCCTTGTTAGCGTACAAACGTCTGTCTCGCTCTCAGGA
TGTCTGGTCCGTCAGTCTGTCCCGAGTGACTCTTGGTTTT
GACGGCGCTCGTCGAGGACTCCGAGGGAAAACTCTTCCAT
TTGTTGAGCCTTTTTCCATGTCTTTATGGATGTGCCATCC
TGACGCCTTCACAAAAGACTCTCATTGTATAGAAGATGAT
TTAAAATCCCCTTCTAGATTTAGCCAGGAGTTTTCATGTG
CTCCAAATGACCTTATATCTAATAAAACCCAGCAGACAGA
ATCTCTAATCAATTCCCCAACAGCATCAGTTCATATTTTA
GCCCAATCCATTACTCCTGTGAAAATGTGGCTCAATCATT
ATCAGTTTATAGCTCTTTTAAGGATGAAGGACTACCTTGG
CAGGCTCGCCGAAGATTTGACTAGGGATTCCCAAGCTGAA
TCCAAAAACAAGTCATCAGATCCGCCATCGGTTTGTGTCT
CAATCCTGATGGAGGCCATTGAGCTTTCTTTGCTGCTTCC
ACCCGCAACGTGCGAGCCAGAACAACAAGCTGATTCTCCA
GGAGAAACGGACACTAACAGCCTGACCGAATCTGATTTCT
CACCATCCCACCGTGCTGATCCTGGGAATGAGGATCCAGA
AGATGAGGAGCAGGAGGGATCAGTAGAGGAGGCCTGTGAA
GCCGTGGAGGAAGCCGTAGATCAAACTCCACACGATGATG
ATGAGGATGGAAGTGTTGCTCCTACAACTCCTCCGGTTTC
CCCTGGGAACTCTGCGTTATTGTCCCGGCACAGCTCTACT
TTCAGCATTGAGGGGGATTTTTCCAGTGCACTGAACGCCA
CTAAAGGGGTCACCAAAGACGCCCTCAGCGCCTCCCTGGA
TTTAACCAAAGGAGCATTGTCCATCACTAAAGATGCCTTC
AGCATGCTGAGCCGAGGGTCTGGCATGAACAAACTCTTCA
CGCCTCAAAACAAGGATCAGAGTTTGCGTTCAGAGGAGTC
CAGTCCCTCCATCATGGGCAGTCTGCGGCTTCAGACCATG
AAACACTCGCCTTCCCAGAATTCCTGCGACAGTGCCATTT
TAGAGGGCAGTTTGGCGGACGACGGTGTATCTGTTGACAG
TGACATGAGTGAAAACTTCGTCATCCTCATGGATTCTGAG
TCTGGTGTGGAGTCTCTGCGTCCCAATGGTACAGGTGTGG
GTTCAGGCAGGTGTGTTAGTCCTGCTGCGGGAACGGAAGG
ATCATCAGCAGAACTCAGCAGCTCTCTGTCCCAGAGCACT
GAAGACATCGCACAAGATATGGCTTCTGTGCTGAGTGTGT
GTCTGAGCCGGATGTGTTGTCTGATGGAGATGCGTGGAGA
AAATGCGGTTCTGGCGCTGGAATCACAGGATATTCTGCCC
AAACAACATGGAAACCATAAGATCTCAGACCTGCTGGCGG
GACTGACACTGACACAAGCTGGTTTGTGGTCCCCCAGTGC
TGCTGGCTCTCCAGGGCCCAGCTCTGCCTCTTGTTCCCCA
GCAGTGCTGTCCCTCAGACTGGAGTCAGGCCCTGCGGCGG
GCAGACACTGCGCTCAGTCTGAGAGTCTGGGCTTCATGGA
GGTGTGTGTGAGCGGGTGCAGAGCTCAGCTGCTGGCCTCC
ACATTGAACACGCTGGGGCCCTTCCTGGAGGATGAGTTCA
GTGCAGACCCCCAGCCCATCAGAGTCTGCCTGCGGGACAC
CACTGTCACTCTCAAGGATGATGGTCCTCGTGTGTACCCG
ACCGCTCCTCAGCCCGTCCCGGTGCTCTTCTCTCTGGATA
ATGTAGTGTTGGAGCGTCTGGATGATGGAGTGCTGCGCTT
CAGACCAGCTCAGAGCCAATCAGGAGCTGAGAAAGAAAAT
GCAGACCAATCCTGCCTTGGAGACCGAGAGAGGAACAAGT
CTCTGGAGGCCAGACTCGCTGACGTTCAGTCGGCTCTGGA
TAAAGCTGTGTGTGAGCGCGAGCGTCTGCTTCAGGAAGTC
AGAAAACACAACCCGTCCTTCACTTTATGATGAGGAACAA
AGGGAAAAACGCAGACGTCAGTCTCACTGCGGCACAGGAG
GAAAATAATCTTGTAAATAAGAACAAGACACATATGCGTT
TGCTGACTAGAAGGTTATAATCCATCCCTTCCCGCACCTT
AAAGCAGTGTTTCCCGACCCTGTTCCCGAAGGCACATTAA
CAGTAAACATTTTCAACCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations