Transcript

si:dkey-26i13.8-202

ID
ZDB-TSCRIPT-090929-21734
Name
si:dkey-26i13.8-202
Previous Names
  • ottdart00000041962
  • si:dkey-26i13.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041962 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041962|OTTDARG00000030320|ZDB-GENE-090312-134 si:dkey-26i13.8|OTTDARP00000033429 DKEY-26I13.8-001 LG_ BX569798.16 Danio rerio protein_coding NOVEL, 3125 bp
CCTCGCGCCAGCACACGCCGCCACAGTGTCTTACATGCAA
GTTTAAAAGCCGCAAACCCCCTTAAACCTTTATGATTTAC
CCCTGTTAAATCGTTCACACTCTTACAAACTAGTCTGTCT
ATATTTTAGGCTGCAGTTAATGTTTTTTAGCTGCTCTGAG
GGGATGGCTTGGCATCTCCGCATGGCAGGTTGTTTTACGC
CTCTAGGGGTTTGATCTCCGTTAACAACAGTCCGCTGGTG
ACTCCAGGACCTCCGCTGAGGCCAGCATGAGATTACCCAG
CCATCAAGAAGATTAACTAACCCACGAACAGGTCGGAGTA
ACGGGAACTCGGGAATAAAAACATGAAGGATTTGCCAGGA
GAATGGATGGACCATCAGCTCACGGTTGCTCTGCGCATTC
GGCCACTAAATGAAGCAGAGATCGAGGAAGGGGCAACCAT
AGTGGCACACAAGATCGACAATCAGATGGTGGTGTTAATG
GACCCCTGCGAGGACTCTGACAATGTCTTGAGGGCACATC
GCTCACGTGAAAAAACATACATGTTTGATCTGGCATTTGA
TTACACTGCCACACAGGAGGATGTTTATGTGGCAACAACT
AAGAATCTGATTGATGGTGTGATCGCTGGTTATAATGCCA
CTGTTTTTGCATATGGACCAACAGGAGCTGGAAAGACGCA
CACCATGTTAGGGCTAGATTCTGAGCCTGGCATTTACATC
CGAACACTCAATGATCTCTTCAGAGCCATTGAAGACAGTA
CTGAAGACTTGGACTGCAGTGTTTATATGTCATATATAGA
GATTTACAATGAGATGATCAGAGATCTGTTGAATCCCTCT
TCTGGATATCTTGAGCTGCGTGAGGACGGTAAAGGGGAAA
TACGAATAGCAGGCATCACTGAATTCTCCACGTGTAATGC
TAAAGAGATAATGGCTCTATTGACAAAAGGAAACAAACAG
AGGACCCAGGAGTCAACAGCTGCTAACAAGACGTCTTCTC
GGTCTCATGCTATACTTCAGGTGACAGTGAAGCAAAAGAG
CCGTGTAAAAGATATCAACGAGGAGGTCAGGGTGGGGAAG
CTATTCATGGTGGACTTGGCAGGAACGGAGCGTGCATCAC
AGACTCAAAACAGAGGAAAGAGAATGAAGGAAGGAGCACA
TATAAACCGTTCCCTGTTAGCGCTGGCCAACTGCATCAAT
GCCTTGAGCGAGAAAGGTGGAAAAGGGGCTCAGTTTGTCA
ACTACAGAGACAGCAAACTCACTCGACTTCTTAAAGATGC
TTTAGGAGGAAACAGTCGCACCGTCATGATTACCCATATC
AGTCCTGCAAGCTCCAATTTTGAGGAATCCAGAAACACAT
TAGTTTATGCTGACAAAGCCAAAAATATACGAACCAAGGT
GAAACGTAATTTGATGAATGTCTCCTATCACCTGGCCCAA
TACACCCGCATTATTGCAGATCTGCGAAGTGAAATTGAAC
GACTTCGGGCAAAGATCGATCAACAAAGTCAAGATCAACT
GAAAGGAGAGAAAGCAGACATCCGTAACATTCAAGCTGAA
GTGCAACAGTACAGTCATGGTGAGATGGCTTTACTGCAGG
AGCAGCTCCTGTCTGCCTTCAGGGAGCAGATGGAGATCAG
ACGCAGCCTCATGGAACTGGAGAACTGCAATATGGAACTG
CACATAGACACATCCAGACATCTGCTCACCATTTCAGATT
GGGAGCGAGATCGAGCACGTGCCAGGCGAGAGAAAGATGA
GTTATCTGGACAGAAGAAACACACAGACAAGGAGGAAGAG
CAAGAGAGCATGCCAGAGGAGCCTCAATATGTTACAGCAG
CTCGAGAGGAGATCGGCCCTCTACTGGCTGAACAGAGGAA
GACAATGGAGCTAAAACGAGAACTGGAGGAAAAACTATTG
AACATGAAGCTGAAGTCATCTAAGATTGAGGAGTTGCTCC
CTAAACGCATAAGCAACACTGAGCAGAGAGACATTCTGAT
GCTGCTTTGTAAAGTCCATGAACTTGAACTGGAGAAAACT
GAAATCCAGTCAGCTGTTCTGTGCAAAGAAAACGTTCTCC
GCACAAAAGACTTCATCATTCAGCGGCACGAGCAGCAGCG
GACGCTCTGCGATGACATCATACACCAGCAGAAGATGCTA
ATTGAAGATCAAGGACTTTGTGTACCTGAGGGATTGCAAG
AGCTTTATTCGCTGTACTTTGGTGAATTAAGTGATGGAAT
CATTGACCAAATACTGAACCTTCACACTTTCACAACAAAC
AATTTAAATGCCAGGCAACTGAGACTTGATGTCATCTCCA
ATTTAGAAGAAGCAGATAAAGCAGAGCAAAGCAACGTGAA
ATTCAGTCCTTTAGATAAACATCCCCGTGACTCTTCTTCA
TCTGGGCTGGATTATGACAGTGACACTAACAGAGTTTTTA
AATCACTGTCTAAAATTAAACCTCGGAGACAGCACCATTC
ATCTTCTAGCCAGACTCTTATGAGGAAGGTTTGTGCTGTT
AAGGATTCAACTCCTATATGTCCAACTGAATCTGTGAGTC
CAGACACTCTGAGGGAAATTGTCAGCGACACTAAAAGCAT
CTCGGTCATAGCAGCGAAACGGCGCTCTCGCCTTCAAGCA
AAGTCCAATTCCAGGATGGCTGGTATGGGTTTGGCCGCAG
GGCTCAACATCTCAGACAACCACCTTGTGCGGCCAGCATT
AAACATCATCCAGCCACTCAATGGCGGTCCTGCAAACCCT
GCAACACCTCCAGTAGCAAAAGTGAAAATCCCGGTTTCTC
ACTTTACAGGTGAAGTACAGTTTCAAAAGTTGGAGATCAG
GGGAACACCACCCAGCACCATCCATCAAAAACACTCAGAC
ACCAAACGAGCGCAGGCCGTCTACAAACGACAGCGAGGCC
AAGGAGATGTTTGTTACCCCAGCAGTCTCCTCCAGCAAGC
AGGCAATTACAAGAAGTCCACCAATGAAAATCCTAAACAA
AAAGCAATGGCCGATGTCAACAGAAAGAACGAAACACGGC
AAAGGAACAAACATGCTGTAAAAAAGTCATACGTCTGAGT
TTTTAGTGCTTATAAGAGAGATCTACTTTTTGCTTTGCAA
TGTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations