Transcript

eif3bb-002

ID
ZDB-TSCRIPT-090929-21727
Name
eif3bb-002
Previous Names
  • si:dkey-26i13.2-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041955 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041955|OTTDARG00000030313|ZDB-GENE-090312-175 eif3bb|no_translation DKEY-26I13.2-002 LG_ BX569798.16 Danio rerio protein_coding NOVEL, 620 bp
AGACCTCTGGAGGCTGATGGCATTGATTCGGTGGTCGTGG
TGGACAACGTTCCTCAGGTGGGCCCTGAAAGACTGGAAAA
ACTAAAAAATGTGATCCATAAAATCTTCTCCAAATTCGGA
AAAATCACAAACGAATTTTATCCTGAAGCAGCTGGGACCA
CCAAAGGGTACATCTTTCTGGAGTATGCTTCCCCTAACCA
GGCTCTGGAAGCGGTGAAGAGTGCAGACGGTTACAAGCTG
GACAAACAGCACACATTCAGAGTCAACCTCTTCACAGATT
TTGACAAGTACATGAACATCAGTGATCTGTGGGAAACCCC
TGAAAAACAGCCATTTAAAGACTTTGGCAACATGAGGCAC
TGGCTTGAGGATCCAGACTGTCGTGATCAATACAGTGTAA
TCTATGAGTCGGGAGAGCGAACCGCCATATTCTCGAATGA
CCCAAAGGAGCCGATACTGGTGGAAGAGAGAGCTCGCTGG
ACAGAGACTTATGTCCGCTGGTCTCCCAAAGGAGACCACC
TCTCACCTTTCACCAAAGGGGAATTGCACTGTGGGGTGGA
GAGAAGTTTAAGCAGATCCAGCGGTTCAGCCATCAGGGCG
TCTCTCTCATCGACTTCTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations