Transcript

rca2.2-201

ID
ZDB-TSCRIPT-090929-2159
Name
rca2.2-201
Previous Names
  • rca2.2-001
  • si:dkey-78k11.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012205 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012205|OTTDARG00000010575|ZDB-GENE-060503-646 rca2.2|OTTDARP00000010498 DKEY-78K11.2-001 LG_ AL845287.10 Danio rerio protein_coding NOVEL, 921 bp
GACAGTGTACACTGCCTTCTTTTGAATCAAGGAATGTTAC
CTCATCAGGATATTATAGTCCAGGTCACACTTTCCAAGAT
GGATCTGTTTTAACATTTGAGTGCATGTCTGGGCACAAAC
CTGTTGATTCAAGAGCAATTAAATCAATTACTTGTATGCG
AAGCCAGTGGACAAATCTGGGGCTCAGTTGCACAAGGAAA
TCCTGTGGGAGTCCTCCAGAATTTGCAAATGGGAGATATG
AAATAACTGGAGTTTTATTTGGTGACACAATTAAACCCAT
TTGTAACAAAGGATTTATGTTAGTTGGGTATGGGTTAACA
CAAAGAGTGTGTCGAGATGGAGGATGGGATAGCAGAGATC
CAGTTTGTGAATCGGTGAAATGTGCAGCACCACCAACTGT
AGAAAATGGACATCTTCTACATGAGCCTCTGGAAAGTTAT
GAATATACACACGTCTTGACCTACAGATGTAATTCTGGGT
TTAGTCTTAGTGGAAGTCCAAACCTTCATTGTTCTGATGA
TGGGACCTTTAAACCAGATCCACCCAAATGTTTGGATGGG
TGTCCAAAGCCTGAAATTCCACATGCAATTAGAATTGGTG
GAAAATCTCCCCCATACAAAATAGGACACTTTATAGAGTA
CAAATGTCAAGATCTCTATACACTGAAAGGAATAAAGGAA
ATCGCCTGTACAGCAGAAGGATGGGATCCTGAACCACCAA
AGTGCATTGAGCCTTGTAGTTTGCCGGATTTTGGAAGAAA
AGTCACTTTAACAAAAGAATTCAGCTCCAAAAACCTTTTT
CCACATGGATCTAAAGTAACATTTAAGTGCAGCAGTGGAT
ATGAGCCAGTTGATTCAACAGCATCTAATTCAGTTACTTG
TGAGGAAACCAAATGGACAAAACTGCACCTGACCTGCAAA
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations