Transcript

arhgef38-201

ID
ZDB-TSCRIPT-090929-21555
Name
arhgef38-201
Previous Names
  • arhgef38-001
  • ottdart00000041697
  • si:ch211-216c6.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041697 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041697|OTTDARG00000030168|ZDB-GENE-090313-83 arhgef38|OTTDARP00000033278 CH211-216C6.3-001 LG_ CU570873.5 Danio rerio protein_coding NOVEL, 2764 bp
AACAAGTGGGAGCAGAGAGGGTCAACATGGATCCCAGCCA
GGCCAGCGGGCATGACAGGGAGAATGAAAAAGGGGAGAAA
AAGGAAAAGGACAAAACCATTAAAAGGAGAAATAGACTTT
TCATAAGATACCTGGAAAGGAGGAAGACAGACACTATTGT
GGATGATGACTCCTCCAAAGGTGACATCAGCATCGCAACA
TTGGTGAGAAGGAGCCAATCTGACAAGACAGAGTACAGTT
CAAAACTTAAAGAGAAAATGTCCCCCCATGGTCTCTCCTT
ACTTGCATCTCCAGCCATGGATCCAGAAGAGATCCGTCAC
AGGAAGATGATAAAAAGGTCAAAGGTCATTGAGGAGCTGG
TCAGGACGGAGGGAGATTATCAACGGGACTTAGAGCTTTG
CATAAATGAAGTTCTGCTTCCTCTGAGAGAAGCACAGGTT
GTGGATGTGGATCGACTTTTCACCAACATTGAGTCTGTGT
GTGATGTCTCTAACGATCTGCTCCTGAGGCTCCAAGATGC
CATAGCTGACCCTGACCCTGAAACACAGCTTATAGGAGAA
GTGTTTATCCAAACCAAAGCTGTCATAGAGGAGGTATATA
AAATTTACTGCTATCATCACGATGAAGCTAATGCCTCACT
TAAGTCTTATGAAGCCCAGGAAGACATTCAGCAGCAGTTC
AGAAGATGCATATCAGCACTCAAGAAAATATATGACCTTG
AAGGGAAGCCTAATTTGCTTGACATGGGTTCTCTACTCAT
TAAACCAGTCCAGCGCATCATGAAATACCCACTTCTATTG
GCTGAACTGTGGAATGCGACACCCACAGATCACCCTGACC
ACAGGCCTTTACAGGAAGCTCTTACAACAGTGAAGATCAT
AAACATCAACATTAATGAGTTTAAGAGGAGGAAAGACATA
GTGCTGAAGTATAAGAGGAGTGATGACGAAACCTCACTGA
TGGGTAAACTTAACAAGTTCAACATTCATTCCATCAGGAA
AAAATCTGACCGCCTGACCAGCTATTTTAAAATTCTCACT
GGTGTCGAGCCACAGGTGAGAGATGAAGCTTTTGACAAGG
AGGAAAAACTTTTCCGTAACCTTGAGAAAGCCGTGAGGCA
GTTAGTGAAAAACATCAGCTGTTACTTGCTCTATACACAG
GAGATGATATCAGTTGCTGTTCAAAATGCACAGGATCTTG
AATCTATAATGAAGGATCCGGATAAAATAGACACAAATGG
CTTTCATCAAAAGAAGAATGGCAACGACCCATACAAACAC
TTTAAAGATCACATGGAGCATTTGGTTGTGGCTCCTCTGT
CTAGCCTGCTGGGAATGTTTGCGTCGCCGCAGAAGCTGAT
ACAGAAGCGTTATGATAAACTGTTGGACTACTGCAGTCAG
CTGGATTCCCGATCTTCAAACGAGGAACAGGGCCTTGCTA
AAAGAGATTACGAGGCCCTCAATGCTCAGCTGCTAGAGGA
GCTGCAATGCTTCAACCAAGCCGCCAGGACCATACTCACC
AACTGCTTGATTTGTATAGTGAAATTAATACGAAAGCTGA
TGGACGCAGCTCAACCGCCTGTCCAACAGCTACCGGTTCC
CTTGTCAAACTTCAATGAAGTCCAAAATTCTATCATGGAA
GAGCTGAGCAACCTTGGATTCTTCAAAGAAAATTCCCAAA
AGCTGATGGAGCGCAAAGTGAGCTTTGAGAAACGGGAAAA
GAAAATGGCTCCAGAGATCCTCAGACAGACAGAGGAACAG
AGGGCTCGGCTCCTGGAAGAGTATCCTGTGAAACAGCTCT
ACCAACTCAAGCGCAACTGCAATGCCTGTCAGGAAAAAGA
CATCAGCCTGCTGGAGGGAGAGCTGGTGGCTCTGCTGGAG
GACAGAGACCCGATGGGCAGCAGCAGCCGCTGGCTAGTGC
ACACTGGGAGTGTGCAGGGATATGTGTATTCCTCATTCCT
GAAGGCTTATAACCCCCAGCGGGAGGTGACGGAGAGGCCG
GATGACTTTGACAATCTGAGTCTGTTTGTGTCGGCCAGCA
GAAGCAGCAGCATGAGGAGCTTTAGCACTTCAGACAGTGT
GTCTCCCCAGTCTGCACCACAGGATGAGCTGGACACCTCA
GATGACCAACATTTCTATGCCGTTTATGCATTCAAGGCTC
GCTGTGAACAAGAGCTCACACTTCAGGAGTACCAACACGT
TCGTATCCTTCAGTTTTCAGATCTCGGCGGAAACAAAGAC
TGGTGGCTTGCTGAATCTAATGGACAGAAAGGCTACGTTC
CAGCAAACTACCTTGGAAAGATGTCATACGCCTAAAGCTA
TTTTTTACATGCAATATTTAAAAGTGAAGTTTTATTTTTT
TTTTAAATATGAAGGTAACTGCTTAATGAAGGCCAATCAT
GCACAACCCTTTTGCACTACAAATGATGCTACCAACAGTG
TTTGCTTAAATTCTATACAAATTATCAACTTAATCAGAAA
AAAAAAATATATATATATATTTTGTGTAAATACAATGATA
ATAATATATGAAAAAAGCTCTATTGTGAATAAAATATTTA
TAACCATTTAAAAAATGTCCTTGTTTGTTTGTGAGGGGAG
GTACAGGTACAAGTACAGGTATATCAAATATCTCATTTTT
ATATAATGATGAGATAGTGGATGTGTTCTGCTAAACATGG
TCAAATCTGAAATACTTCTATTTTGCAAATAAATAATTAA
ACATTAAAAGAACCAAAGCAATAAAAAAAGGTCACCCAAA
AATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations