Transcript

zdhhc5a-002

ID
ZDB-TSCRIPT-090929-21486
Name
zdhhc5a-002
Previous Names
  • si:dkey-28b4.5-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041434 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041434|OTTDARG00000030015|ZDB-GENE-090312-92 zdhhc5a|no_translation DKEY-28B4.5-002 LG_none BX908740.5,BX511158.5 Danio rerio protein_coding NOVEL, 905 bp
CCCTGAGCGCGAGCGGGAGCGCCTGCTGCACGATTCGCAA
GCTCAGCACCATCACCACCACCACCATCATCACCACCACC
ATCGGCCGCCCCGCTTCTCTCGACCCCCTCTGCTCTCTGA
CTCGGGCCCCCCTCAGCCTTCATACCCCTACCGCACCCGC
TCCACCGACACCACCCACCCGCCACGCTCGCCGCACCCCC
CGCCGCTGGGCAAGTCTCTGTCGTACTCTAGCGCTGCCGC
TGCAGAGATGCAGTACCGCCTGGTCCGCAAAGCCTCGGCC
TCGGTTGCGGGAGGGGGCATTCAGGCGCCAAAGTGAGTAA
CTTCCCCTCCAGCTTACGACGCTCTGCGCAGCCTGCTGCC
TCCTTCCTCCTACTCTTCCTCCTCCTCCTCCCAGACTCCT
GGACGAGATTCAGATGAAGTCGTATAGTCGGACAAACGGG
CAGCCAAAGCCTTCTTCCACCCCCTCATCCCCCACTCATC
CCATCAGCGTGTCCACTCGCCCAGGCCAGGCACATTCCAG
TGCCGGCTCTTCCCAGAGTCCCGCGCACAAGCCTGGAGGT
GGCGTGAAGAAGGTGACCGGTGTCGGAGGGACCACTTACG
AGATCTCCGTGTGACAGACGAGCCACAGACTCATTTCTTC
ACCATAGCAGAGAAAAGAATAATAATAACTGCGCACCAGA
CTTTTATTGGTGGCCGTGCAAATGTTAGGAAATCATTGCT
GACCAGCAGGTATTGGTTGGATTTGACATGGAGGAAGAGG
AGGAGGAGGAAGAGCAGGGAGCTACTCATTCATTCATTCA
CCGTCACGTGATCGGACTTCAAGACTTACACATAAGGAGC
TGGAAGACCAAGTCAACGTGACGGCAAAGGACCGGATTGC
CTTCAAAACATTTCAAGTACATAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations