Transcript

ugp2a-201

ID
ZDB-TSCRIPT-090929-21378
Name
ugp2a-201
Previous Names
  • ugp2a-001
  • si:ch73-233a22.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041322 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041322|OTTDARG00000029982|ZDB-GENE-090311-46 ugp2a|OTTDARP00000033008 ugp2a-001 LG_ CU651563.7 Danio rerio protein_coding KNOWN, 1817 bp
GGCTGGTTGTGCTCTCAACAGCAAAGTTTTAGTAGCTTTT
GTTTTTAGTTTAGTCGATCTGAGGCTCCCAGAGGATCTGT
GTGACAGCTTCCTTAAACTGAGGAAGTTGTAGTTTTTTCA
GTGTAACTGAAGGAACTGTACAACAGTGGACATTTGTTGA
CTGCTGAAATCCATTCAGGAGTACTAGACACTGTTATTTT
TAATTCCGAGAGCCGTCATCAGTTACTGATCATGTCTTTT
GTTGCTGACCTGTATAGATCGAGCCCTAATGCGGGAATGG
CGGAGTTTCAGGAGAAGCTGAGACTGCAGCATGAGAACTC
CATGCACACAGAGCTGGAGAAGCTCTTGAGTACCGCCAAA
ACACCAGAGGCCGAGATCTCTAGGAAGGACTTTGAGGGCT
TCAAGAAGCTTTTCCACCGTTTCCTTCAGGAGAAGGGGCC
GTCTGTTGACTGGGCCAAGATCCAGAGACCACCCGAAGAC
TCGATCCAGCCGTATGAGAAGATCAAGCTGAAGGGTCTTC
CAGCTGATGTGGCGTCCAGCCTTAATAAACTAGCCGTGTT
GAAGCTCAATGGAGGTTTGGGGACCAGCATGGGCTGCAAA
GGGCCCAAAAGTCTCATCAGTGTCCGAAATGAAAACACTT
TCCTGGACCTGACCGTCCAGCAGATCGAGCATTTAAATAA
AACGTATAATGCAGACGTGCCGCTGGTGCTGATGAACTCA
TTCAACACTGATGAAGACACCAAGAAGATCCTGCAGAAAT
ACACACATCACCGCGTCAAGATACACACCTTCAACCAGAG
CAGGTATCCCAGAATCAACAAGGAGTCTCTGTTACCGGTG
GCCACAAACATGGGCCTGACGGGAGAGAATGAGGAGGCCT
GGTACCCGCCGGGTCACGGAGACATTTACGCCAGCTTCTA
CAACTCAGGCCTGCTGGACAAGCTCATCGCCGAAGGGAAA
GAGTACATCTTCGTGTCCAACATTGATAATCTGGGTGCCA
CTGTGGACCTGCACATCCTAAACCACCTGATGAGCCAACC
CAACGACAAACGCTGCGAGTTCGTGATGGAGGTCACCGAT
AAAACCAGAGCCGATGTCAAGGGTGGCACACTGACTCAGT
ATGACGGTAAACTCCGGCTGCTGGAGATCGCTCAGGTGCC
CAAAGCTCACGTAGACGAGTTCAAATCAGTCACCAAGTTC
AAGATCTTCAACACCAACAACCTGTGGATGAGTCTGCCGG
CCATCAAACGGCTCCACGAGAAGAACGCCATGGACATGGA
GATCATTGTCAACCCCAAGACTCTAGATGGCGGTCTGAAT
GTCATTCAGCTAGAAACAGCTGTCGGCGCCGCCATGAAGA
GTTTCGACAACGCGCTGGGCATTAATGTTCCCCGCAGCCG
CTTCCTGCCGGTCAAAACCACGTCTGACCTGCTGCTGGTC
ATGTCCAACCTGTACAGCATGAACGCCGGATCGCTGACCA
TGAGCCCTAAGAGAGAGTTTCCCACAACACCACACGTCAA
ACTGGGCAGCTCCTTCACTAAGGTGCGAGACTTCCTGAAA
CGGTTTGAGAGCATCCCGGACATGCTGGAGCTGGACCATC
TCACTGTATCAGGAGACGTGACTTTTGGAAAACAGCTCAC
ACTGAAGGGAACAGTGATCATCATCGCTAATCATGGAGAC
AGGATTGACATCCCGGCCGGAGCCATGCTGGAGAACAAGA
TCGTTTCTGGAAACCTGCGTATTCTGGACCACTGAGGCCT
TCACAACAGAACTACAGCATGACTACAACACACCAGCAAC
ATACCAACAACATGACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations