Transcript

si:ch211-113e8.11-201

ID
ZDB-TSCRIPT-090929-21350
Name
si:ch211-113e8.11-201
Previous Names
  • si:ch211-113e8.11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041284 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041284|OTTDARG00000029959|ZDB-GENE-090313-12 si:ch211-113e8.11|OTTDARP00000032975 CH211-113E8.11-001 LG_none CT737206.10,AL953865.9 Danio rerio protein_coding PUTATIVE, 3802 bp
GGATAAACAAACGATTAACGTGAACCTTCAAGAGCGCTAA
TACCGCATTTCAGCAGATTTCGATCACAGTTCTTCTCTAT
CTCTCGTAGCTTGTATTTGAGTGGTTATGAATTCGCTTGT
GGGATACGGGCTCTCATCCGAGTCAGAAGACGAGGAGACA
GGAGAGGACAATCCAAAGGGCACCTTCATAAAGCCAGAAA
GTGCTGTAGAGCAGACGAAAAGCCGTAATTTCCTGCTGCA
GTCGGAATCTCCGTCCAGTGATTCTGAATCTGATCCAGAA
AACGAAGATCAACAAGAGGCCCCTCAGCCATTTTCAAAGC
CCTCATCCACCCCATCGGTCCGTCCTTACCCACAAAAACT
CCCACCTCCACCTCTGGGCTCAGGTGGAGCGCTTTCTTCA
GCCAGCAGTGTGTTTACAAACCCCTTCAAAGAAAAGGCAG
AGGAGAGTCTGAACGTCCTGCAGAAACACGTACCTCTCAC
TTTACAAGCTCGTCCCACCCAGATTGGCGGGAAGCGCATT
TGTGTGGCCTACAGGAAGGACGGACGCTGCCGCTTTGGGA
GCAAATGTAAGTTTGCACATGACAGCGATCTGCAGAGCAA
CCTTAAGGTCACTTCTGACAGTGGACCAAAAGACACCAAT
GTTACACACAAAAATGATCCCCTGGCTTCTGGAGAGGAGG
ACAAGGAGACTGATGAAGAGAAGGACAATGAACAGAGGAA
GAAGAAAAGAGTCGGGGTGAATGATTCTCTTATTCCACCT
AAACGTGCACTCAAGCAGTATGCCAGACTCTCACATCCAT
AAAAGACACACCGCTTTCTGTCTGTGTGACCTATTTTGGC
TGATTATTCACTTTTGTTTTTGTTTTAAACACTCTGAATG
CTGTTTGTGTTATATCTATTTAGTGACCATTATCTATTAG
TAACACAATTAAGTGTTAATATTAAGTGTTACTAATGAGG
AGGTAAAATCGGTCTGTAAAAATGTGTTACAGACTTTCTC
TAGAGGTGTTTAGTGGACAAAGGAGTATGGAACAAAATCA
ATGCCAAAAGTATTGAAATAAAAAGCTTATCGAATAGCAC
AAACTGAAAATAGCAATACTTCGAATTTACAACTGCTTGC
ATTTTAATGACTTGGATTGCCAGGATTTGTAATTTTTTGG
TCCTGAATTTTTACATAGCTGTTTATTTAAGCTGTGAACA
TCTCAACTAAAAATATTTTAAACACATTTTATGCTTAAAA
ATGTAATAATTCTTATTCAATTTCCAGATTTCACTCACAA
AATATTCAATACCGGTGAAAAATACGAAGTGTAATGTTCT
AAAGGTCATTTTGGGTTTATTTTATATCAGTTCAAAAATT
CAGTGGATCAAATTCGGCTCTAAAAATTTGACATTACATC
CGAGAACTGCAGGAAAAGCAATAGATTGCAGACTGACAAT
CTCGCTGCTTTTTCACTAGCAGGTGGACTAATTTAAGATG
TTTAAACCAATAAATAAGTGAGGAACAAAACAAATAAAAG
CATCAAAAGTAGCATTTAATATTGCCAATGTCAAATTTTA
ACAGCCGAATTTGATCCACTAAATTTATGGAGGCGAATTT
TTGAACTGAAATAAAGTGAATTGAAAATTGTCTTGAATAT
TATAGATGAAATCTGGAAATTAAGAATTATTTAATTTTTA
AGCATGAAAACATGTTGGAAATATTTTTAGTTGACATATT
CACAGCTTAAATAAACAGCTGTGTTCAATTTCAGGAGCTA
AAATTAGAAACCCTGTTAATCCAAGTCATTTAAATGCAAG
CAGTTGTTAGTTCAATGTATTATTTTTCTGAGTTTGTGCT
ATTCGATAAGCTTTTAATTTCAATACTTTTGGCATTGGAA
AAATGTAATGAATACGTGTTAGGATTAAAATGTAGGTCTG
TAGTATAAAAAACTTGTTATATTAGTGAAAATATCGGTAC
ATATTGGTTGCTTGATGACTTTAAAACGTGTTTGGTCATT
GTGTGTTCCCCCTTTTAAACAATTAATTTTTAGTTTGTTA
TATATATTTATTTATTTCTGGATATGATAGAGATTTTCCT
TACATAGAACTGGTTTAAATCAGATGCATTGTTCAGAAGT
ACTTTTAAAATATATTAGTACTTTTTATTAATCAAAGATT
TATTAAATGTATTAAACTGGTTGGCTGTGACTGTAAAGAC
CTTTATAAAGAATGTTTAGATTTCAAATATGGAAAATAAA
ACCCTGCAAATTACCCACTACTGTTTTTTTTTTACACTAT
TAATAAGATTTTCATGGTGTGCTAAATGAGCATATTAGGA
TCATTTTTAGGTCACATGATACTGAAGAGTGTAATAATGA
GACTACTGATGCTAAACGTTCGTCTTTGATATTATAGTAA
TAAGTATAGTTATTTGTAATCAATTTGTTTTGGTAAAACT
TTAGTTAAAGGATCAACTCTCACCTTTAAGTCACTCTATA
GTGCCTGAGTACCATTATTAAGATGTTGGCTGTTAACTTG
TGCATAAGCTAAAAGTCATAATTAATGGTTGGTTACCTTC
CTGCTGCGTTCAGGTCAAATATGACCAATTTACAAGTTGA
AACACTCATAGGTATTGTGTTTTACATCTGATTGCCTCAA
GGCCTTATAATATCCTCCACAGTATGCACTTAATCATGTA
AAAGTGATGATCACCTCTTTCTTTGAATTCTGTTTGTTTT
AATTGTCCATGTTACACATATGGTGTTCCCGGTCAAAAGT
GACCTCTGAAGGAAATGAATGGGTATCTTGACTATAATTA
ACCATCAAACTGAAAACATTTCCATACACAATACCCCAAC
TCACTCACACACATTTCAGACTGAGCAATGTCTTTTGTGG
GTACACATCTCTCCTATGCTTGTGTCGATCCTCCAACGTT
ATGACCTTTATGACATTACATGTATGTTTTGTAATACATT
TTAGTGTCTGTTTGTATTTTCACTGCAGCTAATTTACAGC
TAAAGAATGCTTTTTGACTGAACAGTTAAAAGAAACCGGG
AACACAAAAGTAAAGGGGCGGGAGGTGAACACGACAGGAG
GGTTAATAGCAAAAATTTTAGCAAGACATTTAAATTGTAC
CAACATTTCAGTTTACTGTTTTTCCTCTGAATTTTTGATC
AAATAAATGCAGTCTTGGTGAGCAGAAAAGACTTTTTTTT
ACAAACTTTCAAAAAATATTATCAAACACTAGAAAGATGC
TTCGTCAGTCAGTGTCATATATTTGGTTTCCACTACTTCT
ACCTTCGCATTTCCTTTGCCATCATAAAATGTTTAAAAAA
AAAGATAATTTTGGTGTGATGCCGTGTGAAGTTTTTTCTG
TGTGATGCCTAAATTACATTGTAACATTTCAAACAAATGC
TTTGTTATTAGTTATTCATTTATTTAAGCAAAATAAGATT
AATTTAAATATGATCATTTATACCGTGTGCATCTCTAATT
TCTACAGTACCAATTCACGCCACACGATGGCGCAAATTTG
CTTCACGCACTCAGACTAACATAAAGGTGATAGTTCACAC
AAAAATGAAAATTAGCCATTCATGTACTCGGCCTCAGGAC
TTCCAAGATATGTGTCTTTTTCCTTTGCTTTAGTAAACCA
TTTAAAAAGCTTTAGCAGAAATTTGGTCCTAGGTTATAAA
AAAAAAAAAGTCAACAGCTACCAACATTTTTAGAGTCATA
AAAAGAAAAACAGACTAAAGCCCTGCTCACACTGTGAGAT
TTCAGCCACCATTTTGTCATCGGAGACAAATTTGGGAAAT
CC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations