Transcript

si:ch211-113e8.3-201

ID
ZDB-TSCRIPT-090929-21303
Name
si:ch211-113e8.3-201
Previous Names
  • ottdart00000041236
  • si:ch211-113e8.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041236 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041236|OTTDARG00000029943|ZDB-GENE-090312-74 si:ch211-113e8.3|OTTDARP00000032946 CH211-113E8.3-001 LG_ AL953865.9 Danio rerio protein_coding NOVEL, 3101 bp
GACGCGCAATGTCCAGCCTTGCCAAGACCAGCCCCTATTC
TTCACCAATGAACAGTCAAATTTACAAGCGGCATACGCGT
TACTCCATGGCCGAGACGGACAGTGACAGCTTGCAAACGA
TACGTTGTTGACAAAACAGTGAAGACCTGCTAAATGCAAC
GTCGGCACCCAAATAAGAACATATTTTCGTCGACCTCACC
AAAATCAGGTTGTTTGCTCGAATGAGAGTGAATCTACCGT
CAGATAACCTACTGGAGAGGACAGATTTGCTTGTCTGCAC
CGGCAGCGACCTGATTTAGGGACCGGCCGGAATATGAAAC
ATGGCATCCGCATCTCTCGGGAAAGCCCGAGCGCACTTCT
CATCACTGGAAGTCGTCTTGCCTTTTCGGAGAATATTTAA
TCGGCTAATTTTATGTGGTTAACATTGTTACGCGAGTTTT
TGCTAGTGGTTGAGCCGTGATTATTCTGTAGTGCATCTCC
CTTTTAATATGGATATTTGGACTTGGTTGCGTTAAAGTGA
CCCGCTTTCAGCCTGTCCATCATAATGGATCAAGATGAGA
ACCAAGAACCATGCGAACCCCCTTTGCATGCCCTTTACGG
GCCTAACCGGATTCGGCCTTCTTCGTACCGGGCTCTGCGC
AGTGCCGTGTCCAGCCTGGCACGGATTGACGATTTTTTCT
GTGAAAAAATCGGCTCAGGGTTCTTCTCAGAAGTGTTTAA
GGTGCAGCACAGGATCACTGGGCAGGTGATGGCTCTGAAG
ATGAACACACTGGCCAGTAACAAAGCCAATATGCTGAGAG
AGGTGCAACTCATGAACCGACTCTGCCACCCCAACATTCT
CAGGTTTTTGGGGGTGTGTGTTCATGAAGGACAGCTTCAT
GCTCTTACAGAGTACATAAATGGTGGCAACCTGGAGCAGC
TGCTGGACAGTGACATATATCTGTCATGGACTGTGAGAAT
CGGTCTGTCCCTTGACATTGCTAGAGGACTGCAGTACCTT
CACAGCAAGGGCATTTTCCACCGAGACCTTACATCAAAGA
ATTGTCTGGTGCGTTGTGAAAATGGTGCTTTTACAGCTGT
GGTTGGGGACTTTGGGCTGGCAGAGAAAATCCCTGATTAC
AGTGATGGGGTTGAAAAACAACCTTTAGCCGTTGTGGGCT
CCCCCTACTGGATGGCTCCAGAAATGTTAAGAGGAGAGCT
GTACAATGAGAAGGTGGATGTCTTTGCATATGGAATAATC
CTTTGTGAGATTATTGCTCGAATTGAGGCTGACCCAGATA
TCCTCCCACGGACAGAGGATTTTGGACTGGATGTGGACAC
ATTTGAGCATATGGTGGGAGACTGTCCACCTTCATTTCTT
CAAATGGCTGTCGACTGCTGCAATATGAATGCAGACAGTC
GTCCTGCCTTCTCTGAAATTGTAGTGATGCTCGAGAGGAT
AGAAAGAGAACGAGTGAAGAGTGAAATTCCAGTCATCCTG
GAACCCATTGCCATTGACGTCAGCCCATATCGAAGGAGAA
GCTCGCCATGCCATCCCTGTGACCAGCGCCTGTCCCGCAG
CCAGTCAGATATGCTTCCTCCTGCCACTTCCCCATGTTTA
GGCACACCTGCAAGGGTCAACCCATTCTCTCTTCGGCAAG
ACCTCAACGGTGGCCGCATCAAGCTGTTTGACACCCCTAG
CAAATCCGTCATTTCCCTTACCTTTACCCTTCCACCACCT
CCAGACCCCTCTGCGTCTCCACCGCTGAGCGGGAGCCCAG
GGCTTCGAGGACCCCCTCGAAGGTGTCGGTCCCTGCCCTG
CACCCCTGAACTAGGACGACAGTTACCCTTCAGAGATCAA
GAGGTAGAAGAAGATCGGAGTGAAGAACTGGGCCAGGAAA
CGAAAGACAAAGAGTTGGAAGGACAACAAGATGCGGTGGA
GGACTCAGGCCTGGTTCTGGACTTAGATATGGTGTCTTTA
GAACGGGTTGAGGAGGAAGAGGAGGATGAAGAGGTGGAGA
AAGAAGGACAAAGTCTCACCGAGCCCATGGACTGCAGTAG
CTCACCTGACACGACTGAAGGAAATGTTTCAGGGAAGCGT
TTAATCAGCGGATCATCTTATTCCTCGTCCTTGCAGTCCA
ATGGTTGGGCTACACCCATCTCTAATGGACCACCATTATT
ACCTCCTCTTCCTCGTTTGGACAATAATAATGGAGTTCTG
AGGCCTGGACGTCCATTTGCATGGGTGAGACTGAACGGGT
ACCGAGGCCCTGCTCCAGAACCTTTACCGCCTACCGAACA
AGACGATGTGATTTCGTGTCCAGCCTGCTGTCTGGCCGGC
TTCAGCTTCCCTTCCTTGTGCCTGCGTGGAGCTCCTCCAT
CACGCCGTGGGCCTCCACGAAGACCCTACAGGACCTTTAA
CGGAGGGGATGCATCCACAGCCACAGCAAAGGGACTGCTC
TGTCGGGGAGCGACAGGTCTGGCTCCGTCCACTGCATCGT
GTGAGCCAGGGTTACCTCTACCAGAGGCCCAAACCTAAAG
ACGACCACTGCGACATCTCAGAAACTGCACCATATTCAGA
ACGCAGCGCAGTCAGGTCGCATCTCTGATGTCAGTATGGA
TATCTTTCTGGATGCTGTGCGGGTCGAACTGAATCAAAGG
GATTGTTCACCCCAAAAATGTCATTGTAATTCTGCGTAGG
CCAGTTTATATTGCACTGACCAAACAGAGAGCCTGCTTTT
GTTTGATTAGCGTGTTATTCCTGTTGGCATGTGCTGCCAT
TGGTTGCTTATTTGTGCCAGTTGAACTTGTTCATTAGGCA
TTTGATGGGTTTTAGAGCGTCTGAGATGTGGCGTGTTGTA
ATATGGTGATTATCCACATTGGTTGGAATCTGTTGATGCA
AGTTAAATTGCCGTTTCAAAGTCCACCGTATATTGAATTA
AACATTGTGGTACGGTTTAGTGAGTTGGCTAAATTGCGAT
TTTGTTCAACAATAGAGCACTTTAAACACAGATATTGTTT
TTTAATTTATACAGGTTTAAAAACAATGTTTAACACTCAA
AGTGAAGTTTATTTATAAACAAATTTCAAGAGAATCATGT
GCTTATGATTGTCCTCAGTCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations