Transcript

sertad2a-202

ID
ZDB-TSCRIPT-090929-21287
Name
sertad2a-202
Previous Names
  • sertad2a-001
  • si:ch73-131e21.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041220 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041220|OTTDARG00000029934|ZDB-GENE-050309-236 sertad2a|OTTDARP00000032933 sertad2a-001 LG_ CU467849.10 Danio rerio protein_coding KNOWN, 1012 bp
CTTACGTCACTGTTGAAGACTCCGCTTGCGGGTTTGTTGA
AGGCGGAATAGTAGATCCGTCGGTCCGATGACCGGAGCCG
CTGCATGGCCTCACGAGCTGCAGACTCGTAAATACCGTAG
AAATCGAACGGAGAGGAAAAACGGCGAGCGATTCCCGAGT
CCGATGAGCAGCTCGAAGTCCTCGATTGACCTGCAAGCGA
CAAATGCTACATGTTGAGTAAAGGCCTGAAGCGGAAACTG
GAGGACGAGGACGAGCCAGAAGTGAGTAATAATGGCTCCA
GTCTGGACGAGTCTGAGTCCGAGTCCTCCAGCGGCTACAG
ACTCCAGCGGCAGACGGTGCTCAATCTTTCCCTGCTGAAG
CTCCACAGCGTCCCGGGACACTCAGAGCCACGTCTGTCCC
GCCGGGTGCTCATCTCCAACACCCTCCGACACATCAGGGA
TGAGCTGCGGGTGGAGGGCGGCGCTAGTGTCCGTCTGCAA
CCCTCTATCACTAAGGACGCTTTCAGCTCAGCACTGGCTG
ACATTGAAGATCTGTGTCCGACTGTGGGAATCACGGCTCT
ATTTTCCACAGCGGATGTTTCTAGTAGCAGTGAATCGGTT
CATTCTGATGAGTCGAGGAGTGTTGATTCGGATCTTTCTG
AAATGAGAAGCAAGTCGCTTTCTGACTCCACCCACCCTGT
GTTAGGACACACCTCCTCGCTCATCGCCGATTTCTCATTG
GACGATTTCCTGTTTACAGAAATAGACAATTTTTTATTGG
ACAGCAAGACTGGTTTTGGTGGCGCAGGGATTGGCCAATC
AGCGCTTCAGACGAATCAGACGTTTAAATTAGATCTGAGC
GAACTGGACCACATCATGGAGGTTTTGGTTGGGTCGTAAT
TATTTTGACATTTACATTGTCGGTTTCATTTTAACGTGAA
TTTAGTTTTTAAAGTTTTTTGTGCTTTATCATGAAATGTG
TTCAATTTTCTTCATAAAGGGTTACTTTGGCAATGAAAAT
ATACGCTTATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations