Transcript

galntl6-201

ID
ZDB-TSCRIPT-090929-21255
Name
galntl6-201
Previous Names
  • si:ch211-15e22.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041182 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041182|OTTDARG00000029910|ZDB-GENE-090312-115 si:ch211-15e22.3|OTTDARP00000032904 CH211-15E22.3-001 LG_none CR391923.9,BX927375.6,CT583668.7,CU462871.12 Danio rerio protein_coding NOVEL, 3005 bp
AGTTCAACAGCTCAAACCAAACCTAAGGATCGCTCTCCTC
TCACTGTGCGCGCTCGTGTTTGGTGTGTAGCCTCCAGACC
GCTGCTTCTCTCTGCTGTCCCACACATCGGAAAACATCGC
CCGGCTTGCAAGGATGTTTTCACATTAATGCGCAGCGCAC
GTGGTTTATAACCGCAATATCTAAAATGTTGGGGTAACGA
GAAGTCGCCCAAGGAGGAACGAGAAATATCCGTAAACCTT
CAGTAGGTGGTACGCCCGCGCGAGGCTTTTAAGGAAGAAC
ACGAAACGATTCTAAATTGTATCTCGAGTGCATTGCCTGA
GATAAAAACGCAGCGCTCGTCGTTGTCCAGCAATTATCTT
ACTCTCTCGCGTGTCTTCAGCCAAGAAGAGAGGATTACCG
AGCAACATACATGTCTCAACATGCAAATATCCCTCTACTG
TGAAAGTTTGTCGTCTTTTGCGAGGGGAGAAGCGGAGCTC
GAGTGCACACACGGCAGACTCACGTTCATCTAGCGCTGGA
TTGTGCCTCGTGTGCGTCTTCAAAATGAAGAGAAGGCAAA
AGCGCGTTCTGCAGATGGCATTTCTGTTCATGGTGGCTTT
AATTTTCCTGCCAAACGTCGGCCTTTGGTCAATGTACAGA
GAGAAGAGCCTTATGAAGTCGCACGAGCCTGGAGAGCAGG
GCTTCCCACTGGGCTTAAATGACGGTCACATTTATACCTG
GACAGACGGATTGAGGAGAAGAGACTGGCATGACTATGAG
AGCATCAGGAAAGATGGGCAACGTGTTGGAAAAGGAGAGC
ATGGAAAGCCATACCCGCTTGTTGAGGATGAGTGTGATGA
CTCTGTGTACAAAGAGAATGGTTTCAACATCTACGTCAGC
AACAATATCGCTCTGGATCGCTCGCTTCCTGACATCCGAC
ATCCAAACTGTAAGCAGAAGCTTTATCTTGAAAACCTCCC
AAACACGAGTATCATCATCCCGTTCCACAATGAAGGCTGG
TCCTCTCTGCTCAGAACCCTCCACAGCATCAGCAACCGAA
CACCGGATCACCTGATCGCAGAGATCATACTGGTGGATGA
CTACAGCGACAGAGAGCACCTGAAGGCACATCTGGCGGAG
TACATGTCCAGATTTCCTAAAGTCCGTATTGTGCGCACTA
AGAAGCGAGAGGGTCTAATCCGCACACGACTTCTGGGAGC
ATCTGTGGCCAGAGGAGAGGTCCTGACTTTTCTGGATTCT
CATTGTGAAGCCAACATCAACTGGCTGCCACCCTTGCTTG
ATCAAATCGCCCAAAATCCCAAAACCATTGTATGCCCCAT
GATAGATGTGATTGATCATAATCACTTTGGGTATGAAGCG
CAAGCTGGGGATGCCATGAGAGGAGCTTTTGACTGGGAGA
TGTACTATAAACGTATTCCTATCCCACCTGAGCTGCAAGG
ACCAGACCCCAGTGACCCATATCAGTCTCCTGTGATGGCC
GGAGGCTTGTTTGCTGTAAACCGACAGTGGTTCTGGGAGC
TGGGAGGTTACGACACAGGCCTTGAGATCTGGGGTGGCGA
GCAGTTTGAAATATCCTTCAAGGTGTGGATGTGCGGAGGC
AGCATGTACGATGTGCCTTGTTCGAGGGTGGGCCATATCT
ACAGGAAGTACGTCCCCTACAAGGTGCCTTCAGGGACCAG
CCTGGCAAGAAACCTGAAGCGAGTTGCAGAGACATGGATG
GATGAGTACACAGAGTACATCTATCAGCGGCGGCCCGAGT
ACCGCCACCTTTCCACCGGTGACCTTACCGCTCAGAAAGA
GCTCCGAAAACACCTCAAATGTAAAGACTTCAAATGGTAT
ATGAACACTGTGGCTTGGGACCTGCCCAAATATTACCCAC
CTGTGGAGCCACTGCCAGCTGCCTGGGGAGAGATTCGTAA
CGCAGCATCTGGCTTATGCGTCGACTCTAAACATGGCTCT
ACAGGCACTGAGCTCCGATTGGACAATTGTCTGAAAGAGG
GCGCAGAGCGAACATGGGCACATGAGCAGATTTTCACGTT
TGGCTGGAGAGAGGACATCAGGCCTGGAGATCCACTGCAC
ACCAGAAAATTCTGCTTCGATGCTATTAGCCAGAACAGCC
CTATCACGCTCTATGACTGCCATGGCATGAAAGGCAACCA
GCACTGGAGCTACAGGAAGGATAAGTCTTTGTACCACCTG
GTGAGCAGCGGTTGCATGGACTGCAGCCCGAACGATAAGC
GGATTTTCATGAACAAGTGTGATCCCAAGTCTGAAACACA
ACAGTGGATCTTCCAGAAAGTCAACGCCACCGTTCTGGAC
AAATTCAACAGCGCCGCCAGCTCTTAGGACCTGGGGTTGT
GGTCAAGCCAATTACAAAGAATAATACTAATCTGGCTTCC
ACACATAAACACACCTCCCACAATCCTTCACGTGGGCCGG
GATGTTCTTGGTTTCTGGTTCCTCTCGAGGTTCTACTGAA
GACTGAGCAAAAATGAGGGGACTGGAAACAACCGAGAGAC
TCAAGGCTGGTGGAAAACATTTCCACAATGAGCACCTTGC
TGGTCGAGGAGAATACAGACAGCCTGGACTCTCTCACGGG
GGTCTAAATTGGGCCCTAACCTTGGGAAGAAAAAAAAAAC
AGAGCAGCTTTAGGACTTCGGAAATGGAGTCCAGTGAGAG
ACTGTTCTGTAGCAGATTGCATGGGGGATTTGTACAAAAA
GCAGAAACTGGAAAGAGTTTGCTCCTGGTTTTTATTTTTA
TTTAATTTGTATGGCTATTTATTTGATTATTGGGGTCGTT
TAGACTGTATATTTATTTGTATTTATTTGGTGCCTTTTCC
AGATTTTAGTTGTGTATATTGACTGGGTTTTATTATTATC
TCTTGTACCTGTTAGAGTCAGACTAGGGGTTGAGATGGTG
ACCTTAAATGAGGTATTTGACTTTTTTTTCAATGGAATCT
ATCTTGTTACAGACTTTCTCGTCTATAAATAAAGCAGAAA
ATGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations