Transcript

samd1b-201

ID
ZDB-TSCRIPT-090929-21206
Name
samd1b-201
Previous Names
  • samd1b-001
  • si:ch1073-258o11.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041128 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041128|OTTDARG00000029879|ZDB-GENE-090313-2 samd1b|OTTDARP00000032859 CH1073-258O11.1-001 LG_none CU571167.5,CU570685.8 Danio rerio protein_coding KNOWN, 2570 bp
AGCGGATCACTTCGGAGACAAGAGAGAGAAGCGCTCGGCC
GAACCAGTGCGCAATCATGTCGGAACCAAAATACCAAGAG
TGGATCCTAGAGACCATCGACTCTCTGCGCTCGAGAAAAG
CGAGACCGGACCTGGAGAGGATTTGCCGGATGGTTCGAAG
AAGACACGGGTCAGACCCGGACCAGACCAGGGCTGAACTA
GAAAAACTGATCCAGGAGCAAACTGTGCTGAAAGTTAGCT
ACAAGGGGTCCATTTCGTACAGGAACGCAGCTAAAGTGCA
AAGAAAATGCAGAAAGAGACCCGAGCAAACCACCGACAGC
AGCAGCGGCAGCGGCGAGTCAGTGGCAGAACAAACCAAAC
ACGCCGCGTTCACAAACACCGGCGACAGCGCGCTCAGCCT
CACGGACCAGGAGGAGGAGGAGAGCGGAGACAAGGAGCCC
GAGGAGCCGCGGGTGAGCCCCAGTCCTGACCCGCCGCTTC
AATCCTCGCCCTCCACTCTCGAAAAGGAAGACAAGATTTT
ACCACTACATAGCGGAAACAGTTTGGTTAGTTGTGGCGCA
ACGGGCTGCTCTGCCGGGAGCGAGAAAGCAAGTGCATCGA
AAGAGCGGAGATCAGTGTCCGCGGCGGGGGGAGGCGGCTC
TGGCCCCCGCGATGCTTCAAGTGCAGGAGAGGAGATGTTG
AGCGCGGGCCACGAGGGCACTGATGAGGAGGAGGAGAAGG
AGCAGAAAACTTGCTCGAGCGTCAGTTCGCCTCAGAAAAA
CAGGCTCTCTGCGCCCTCCAAACTCAAGCCGGGGGTGAAG
GGCTCCGCTGTGCGCGGCTCCGATTCCCCGGAGGAGAACA
GTACCGATCTGGGCGACAGATTAATGGATGCTGTCCGAAG
TATGTCCGAGAGACACCGGGGCTCCGCCGCAACACGGGGC
CACGCACCGCCAGGGCTGAAAGAGATACTCGACTACCTCT
GCACACAGAAAGGCATGCCCGGCGAGAAGCTGACCCGCAA
CCGCGTTAAAGTGGTGCTGGAGCGCGAGATCGAGAGGGGT
CGGCTGCGCAGGACCCGCCTCGGCCACATCACTCTACCCG
CGAGGGGGATGGGGGCGGCCAAGCCGTCCGCGCGACTCCT
GAAGAGCGCACTGCAGGACAGACATCTCGCGAAAAAGGAA
GAGCTGAAGGATGAAGATGGGATGGAGGTGGAGAGTGAGG
GAAACGGCACAGAGGAGCCGACAGCGGAGGATCTCCCCGA
AACCGTCCCTGATGAAGATCCCGTCAGTGTGAAAACAGGC
ACTGAGCCGCCGTCACCCGAGATGGAGGCCGAGTCTGATC
ATGCCACCAGATCGCCCATGATGACATGTGAAGGGGAATC
CCAGACTTCATCATCTCTGCAGCTGTCAAACCACTGCTCC
ATACTGCAGCAGGCAGACGTGGGCGAAAGTCAAGAGCAGA
CAATGTGTGCTGAAGCTGAGGATTCTGGGACAGAGAAACC
CGCAGATCCGTCTGATCAGCGACATCCCAGCGTGGAGGAT
CAGATGCTTGTTATGTCAGAAACTGTAAAGCCGCCATCAT
CGATTCCTATAAGAAACTGCTGTAAGCTGGAGGTGGGAGT
TTCCTCATGTCTGCTGACTCCCTCTGCTTCTCCAGGAGCC
GCTGAAGAACGAGGGATGAATGAAGGAATAGGCTTTGTGA
AGTCAGAGTCCAGTGTGGTGAGTCCAGTGGACTGGACAGT
GGCAGACGTGGCCAGTTACTTCACTGCGGCTGGGTTTCCA
GAGCAGGCGATCGCCTTTAGGACGCAGGAGATTGATGGGA
AGTCCCTTCTTCTAATGCAGAGGAATGATGTGCTGACAGG
CTTGTCAATCAGACTTGGCCCCGCCCTCAAGATCTACGAA
AGACACGTGAAGGTTTTACAGAAAACACATTTCCAAGATG
ACGAAGCTTTCTGCTGATAAAGTCACACACTCATGTGTGC
GTGTGTATAAATGTATAAATGTGTGTGCATATATATAACC
GCATTAAAAAACTGAACAATATTTACTTCACACACATAGT
CATGCGTACAATGTATATATATTTTCAAACCGTAATCCCA
TGGATATTGGAATACAAATATTGTCTCTGCGAAAACTGAC
TGGAATGAACAGAATTAAGCTGAAAGAGGAGTATATGGGG
ACTAAGAAGACTGAAAAGAGAAATATAATGTTGTTTTTTT
GTGGAAAGACTGTTTTGTGCAGTTAATGCTGCTCCAGTGG
ATGCCACTGTTTGGGTCGTGGCCTTTGACCCTGAATTCAT
TTCATGAAGTGGATTTCTTCTGCAGAACCTCCACTAGAGG
GCAGAATTTCATTGTCTATGTAACCTCAAACAAAGACTGG
ATGTGTTTCCACAGCGCACAGTGATACTTATTTGCTCAGA
AACAGTCCGGCTACAGTTCTGGAGATATACATTCTGATTG
GAAATTTGTTCTCGGATGATGAACTTTTTCTTGTAATGGT
CTTCCTTCAGTGATGGACTACATGTCTTCTCTTTCTGATC
TGGAGCATCTAATGTTCTTCCCAGTGTTTTTTGCGTCTTG
CTTCATTACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations