Transcript

kcnf1b-202

ID
ZDB-TSCRIPT-090929-20904
Name
kcnf1b-202
Previous Names
  • kcnf1b-001
  • si:ch211-12d10.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040800 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040800|OTTDARG00000029684|ZDB-GENE-090312-39 kcnf1b|OTTDARP00000032610 CH211-12D10.4-001 LG_ BX470227.9 Danio rerio protein_coding NOVEL, 1363 bp
CTCTTCGAGCAGTGATGAGAAGGAAATCGCCGTGAACATC
GGCGGTGTGCGGCTGGTGCTGTGCGGGGACATTCTTAATC
GCTATCCGGACAGCAGGCTCGCCGAACTCGTCAACTGCCC
AACTCGTAGTTTTGATGTCATTTCCTCACTCTGTGATGAT
TATGATCCCGGGAAACGAGAATTTTACTTCGACAGGGACC
CCGATTCATTTAAATGCATCGTAGAAGTCTACTACTTTGG
GGAGGTCCACATGAAGCGCGGGATTTGTCCTATTTGTTTC
ATCAAGGAGATGGAGTTTTGGAAGATTGACTTGAGCTACT
TGGATGAATGTTGCAAGAGTAACTTAACCGAGAAAGAGGA
AGAACTGGCTGAGATTGCGGACAAGGTGAAGCTGATTCTG
GATGATCTGGAATGTGACCCTGCTGTGAGCCGCACGGAGA
GGTGGCAGAAGTTCGTCTGGAAGCTCATGGAGAAACCAGA
GTCTTCACTCCCCGCACGCGTAATCGCCGTCGTGTCCTTC
CTGTTCATCTTAATCTCATCTGTGGTCATGTGTCTCGGGA
CTTTACCGGACCTCCAGGTGGAGGATTCTGAAGGGAACCG
CGTTGAGCACCCGAGCTTGGACGCTATCGAGACGGCGTGC
ATCGGTTGGTTCACGGTGGAGTACGTGCTGCGCCTCGCAT
CCTCCCCTAACAAGTTGCGCTTTGCGCTCTCCTTCATGAA
CATGATAGACTTCTTGGCTGTTCTGCCATTTTACGTGGTA
CTGGTTCTCACGTGCCTTGGCACGGCCATGATGGAGCTAG
TCAACGTGCAGCAGGCGGTGCAGGCACTCCGCATCATGCG
CATTGCGCGGATCTTCAAGCTGGCGCGCCATTCTTCTGGA
CTTCAAACTCTCACGTACGCGCTCAAGCGGAGCTTCAAGG
AGCTGGGGCTGCTCCTTATGTACATGGGGGTGGGCATTTT
CGTCTTCTCTGCGCTCGGGTACACCATGGAGCAGAGCCAC
CCAGAGACCTTATTCAGAAGCATCCCACAGTCGTTCTGGT
GGGCCATCATCACCATGACCACTGTAGGATATGGGGACAT
CTACCCAAAAACCACCCTGGGACGGTGCAACGCGGCCATT
AGCTTTCTGTGCGGGGTGATCGCCATAGCTCTGCCCATCC
ACCCCATCATCAATAACTTCGTCATTTATTACAACAAGCA
GAAGGTGCTCGAAACCGCCGCCAAGCACGAGCTCGAGCTC
ATGGAGTTGCGCGCGCTCGAGCTCACTGTCAGAAGCGCCT
CGCGCAGGTCTGACGCGCCCGGGAGAGCGTGGGAAGGTGC
CATGCGCGCGTCGCGTAGCGATACTTTTATCCCGCTTCTG
TCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations