Transcript

si:dkey-192p21.6-202

ID
ZDB-TSCRIPT-090929-20893
Name
si:dkey-192p21.6-202
Previous Names
  • si:dkey-192p21.6-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040788 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040788|OTTDARG00000017729|ZDB-GENE-060503-809 si:dkey-192p21.6|OTTDARP00000032598 DKEY-192P21.6-003 LG_none BX005252.15,BX663512.4 Danio rerio protein_coding NOVEL, 790 bp
GTTTGAACTGAAGAGGCCTGTGATGCAGTTGGGTGACTTC
ACACAGTGAGATAATAATTAAACCGTGAACAAACTTTAGC
AGTAGAACTTATCGAGCATTCATGCAGGTCGTCAGCAGGA
AGTTTACTCCCAGCAGGGCTGTGTGAGACACATCATGAAG
TTTACAAGCTGAAAATGGACGAGGCGCTGATAAAATTCCA
TAATGAACTTCCGTACAACATTAGTGTTTACTACACCTCG
GATTACTGTTATAAGTGTCTTTATCAGCCTCTTGCCACTC
TTGGAATTGGGCAGAGTAATATTTCTGTGATTGTAAGCAC
ACAATTCAAATTGACTCTACAAATCACATCAATAGTTGGA
ACCGCCAATCTTTGCAGTCTGAGTCAGACATTTGAGGAAG
CTGGCCATTATTCTCTGTGGATGAGGAAGCAGGGCTTGCT
AAAGGATGTAACCTGCTCTCTCACTGTGGACAGGAGTCCA
AATAACGCATACCTGCCACTGTTGGCGGCGTTCTTGATTC
TGACTTTCATTGCTGCATTTTGGGTCTCTTTACCTTATAT
ACTCAGATTACGCTGTTCTCAGAGGCTAAAGAATCGAATG
TGTCACCACGGGTCTCAGAACTCCATGGAAATGGAGGAGC
CTAATACCGAACAACAAATTGACGAAAGCAAACCGAAATC
ATCAAGACTGAAGTCACTGGACACATTCAGAGGATTTTCC
CTGACTGTGATGGTGTTTGTGAATTATGGAGGAGGTGGTT
ACTGGTTTTTCCAACATGCACCATGGAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations