ZFIN ID: ZDB-TSCRIPT-090929-20880
Transcript Name: cfap43-201
Previous Names: cfap43-001, wdr96-001, si:ch211-223p8.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040775 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040775|OTTDARG00000029668|ZDB-GENE-080815-3 cfap43|OTTDARP00000032586 CH211-223P8.5-001 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 5120 bp
GCTAAGGAAACGGACGCAAGCACAGATGGTGGCTGAAATG
GATGTGCTGCGAAACTTCGAAGTTCAATGGGTGCAAGGAT
TCACCAATGGCACATTTAGGTTTGTCGACAAGAAAACAGT
TTGCTACACCTGCGGAAACTTCATCGTTTTCCTCAATGTG
GAAACTAAAGAGAGGAAGACGCTGCAGAGTCCCGGCTCTG
GTATTGGAGCATTTACAGCCAGTGGGCAACGTAGGTGTAT
TGCTTTCTCTGATCTCGGACTCAAGCCTTCCATCTTTATC
TACAAATATCCAGAGCTTGAGCTGACAAGTGAACTAAAAG
GCACAACTAAACTGGGCTATACGGCTTTGGCACTTTGTGA
TACTGGTCCTTATTTAGTTAGTGCATCACCCATGCCTGAT
CACATCATTACGTTATGGAACTGGGAGAGTGGCCTTCCAC
TTTGTAGCCATTCTCTTTTGGATGAGGACATCTCAGCACT
GGTTTTTAACCCCATGAACTGGTGTCAAATTTGTGCAATA
AAATCAAAGTCTCTAACCATCTGGAATGTTGAAAGATGTG
ACAACTACCATTTAATGAAGCCTAGTGCTGTCAATCTCCC
TGGCACTGATGGGTCAGCTATTGAGTGTGAACCAAATCAG
TCTCATTTACTCAATGGGAAGCTGACATACTTAGGTCCTC
AAATGCCCACTTCAGCAATAGCTGGACTGATTGGAGACCA
AGCTGACAACTTTGTGCCTTTGAAACTAATAAAACCTAGA
CTGTGTCCTAGTGCCATCTGCTGGTCAATTTCTTCTGACC
TGTATGTTGGTTGCAAGGAAGGTTTTCTGCTATGTGTGAA
TCCTGAAACTTTGCATGTCTCCGTTTTATATAAACCACAG
ACCGAAGTAACCACAGGTAATAGTGAAATGCCCATGCAGG
AGGGCAGTTTCCAGAGCTTAGTCCTCCAAGACTCTAAACT
CTTTGCTGCAGGAATGGAAAGTGTTTTACGAAGCATACAA
ATTAAAGGAAACAAACTGGAGGTTGTGCAGACCTGGGCTT
TAGAAGAGGCAGCCTCTGCTATGTGCTTTTCTCCTGATGG
TGAGACACTGCTGCTAACTTCTAATACAGGCTGTGTTTAC
AGATTCAAACCACTGCTAAAGGATAAAGCTGTCAAAGTCC
TGGATGTCCTTTGTGGAGATTTTGTGACTGTTGCTCCAGT
TTACACTGATAGAAGCATTTGTTTGTCAGTTAGAGAAGCA
GGAGTTGTACAGCTTTGGACTCTGGATGATGGACTTTGCA
TGGGCTCCATCTCTCTGCAAACTCACGTAACTAGTATGGC
ATGCTGTCCCATAGCGCAGTACATTGTGGTAGGGACTGCC
ACCGGAGATGTGCTGTTTGTGGAGATGACCACAAAACAGA
AGCCCAGACTAGTTCACAGAGTTCATCTCTACCACGTCCC
TGTAGACCATTTGGTATTTGATCAAGGTGGCAACTGCTTA
ATCACAGGGGCGTCAGACTCACGTGTGTTTGTGCTGGATT
CAAGACCATCAAAAGGATTTGATATTATCGGATGGATTGA
GGCTCCAGGTGCGATCGTAGGCCTCTCCACTCAGTACCAC
CAAGAAAGTAAACAGATTAAAGTTCTGGTTTTATGCAACA
AATCAGAGAAAGAAATCAGCGAGGGAAATGTGCTTCTGCT
ACTGACATTATTTGCGCAACAGCTCACAGAATCAACCAGT
TGTATGGATGCCCATGGCTGTCTGCGTAAAGAAGTGTTTG
ACAGCTGTGTGTTGGAGCTCCCTAACTCTCTCTGCTCTTG
TGTACTGGCCGTAAACAAGATATTTGGTTACTGCCAACAA
AGAAAAGTCCTGCAAAGATTCAGTATCCCTGAGAATGGAG
AAAACCCTAATAATGTAGTTCAGCTGATTCCAGAGAAGGA
GACAGGAGGCCATTTATTGAGTCCTGCATTTCTCCAGCTT
TCTCCACATCATACCTGGCTGGCATCGGTTGGCAGAGACG
GGCTGCTACGCATCTGTGAGATCTCAGAAATGGACAGGTA
TGTGCAGCTGCAGTGCCACTCATGTTGGCAGGGTGGAGTC
GGGTCTGTTTGTTTCACCCCAGACAGTCAGACCATCATCA
CCTCAGGCCTAAGAGACGGCTCACTTGTCTGCAGCAGGTT
GAAGCTTTCTGGAGTTGGCAAAGCAAATGCAGCTACCCAG
TATTCTCAGTCTGTTGCTGATTCTTTTGAGTCAGTGGTTT
CATCAGAAAACACTGTCCTCACCAAAATGACCGACCGGGA
TTCATTTCATACAGGAGAGGTCAGTCTTAAGGGAAAGATG
AGTCACGAAGCTGAACAAGAGGAAAACTATTTTACATCCC
CAACTAGTTATACTTGGCTTGATGGGAAACTTGACGCGGT
TCTCCAAGAGGAAGCCCAGCAGTATGCAGAAACCAAGAAG
AACCTAAGAAGAAACATAAAGGTTCTTCGTGATACAATTA
AAGCTATGATGGAGGAGAATGAAAGTCTGGCAGACATAGA
GAAACTTGAGCAACAGGAATTTAACCTGGATGTGGAAGAG
CAGCAGAGGCTGCAGCTCGAGGGAGATCAGGAAGTCAACA
GGGTGAGAAAGGAGATCGAGATGGAGAATCTGGCCAAGTC
CTATCAAAGAGAAGTCTTGAAGAGAGAATGCTGGGATTCT
ATGCAAGTCAAAGGGAAAGCCATTAAGGCTTTTCATTCAG
AAAACGAGGTGAAAAACTACCCAATGAAGGAACGCACTGC
AAAAGAACTTGAAGAGCTTCGTATGGTTGAGAACATGAGG
CAGATTGAACAGGAGGATTCACAACTTCAGGAGGGGGTTT
TGGATACACTCTTTGGAGACAAAGAGGAAGAGGTCAGTTT
GACTGAGAGTCCTGCTCTAACCGGCAGTCTGAGCTCTCTA
TATGGCGGTGTCAACCCTTATCTCTACAACCAGTTTAACT
TACACGTAAGAGAGCAGAAAATCAACCAAATCACCTTGCT
CAAGGATGTTATATACAACGTTAAGAGTGCATTCAACAAA
GAATTTGAGGCAGTTTACAAGCAGAAGGAACAGGAAATCC
ACAGAACCAAAGAGAAGAACAAGCGTATCTTTCAGATTAT
GGCCAAGCTGGGCATAAGTGAGACCCTCTGGGAGCCTAGA
CTCACTGATAATGAGTGTCCTGAGAGAGCTCTCACTGTGA
CCGACTCAGAGATCAAGGTTGAGAAATACCTCACCCTCGA
GCAGAAAGAAAAAGAAGCAAAACTCAGAGAGGAAGAAGAA
CGGCAACGGCTTGCAGCCAAATCTGAAAACATGAGAGATC
AAGGACTCAGTGTGATGATGGGTGGCGTTCTGGAGCTTAA
GAAAGAGGATGTGCTGAGGATGGAAGTACCTCAGCCTGAG
TTCATGTCTAAACCTGAGGCCCAGTGGACAGAAGAAGAGA
GAAAGAGCTTCAAAGAGTTTGAGAAAAAAGCAAAGGAGCT
CAGTGAAGAGCAAGAGAAATATAGAAAAACACTGGAGACA
GAGATGAAGAAACTGCTTACATCTATTAAAGAGGCTACTC
AGATGTTTGACGAAAAACTTGCCAAGCTGTTTGAAAGGAA
GGTGAAATCAGAGATGGTCATATACCAAGAGGAGCTCAAG
ATTGCAAATCTGGTTCTTTCCATTCAAACAGAAGAAGAGA
TCCTCACCAGAGAGAAACAGCTAAGCTTTAAACTAGAAAA
GGCACGAATTAAAAAGAATGAAATTGGGGAGGAATTGAAA
AAACACAAGGAGACTGTTGATGAGTTTAGAGAGGCGTATG
ATAACACAGTCGCTGAGGACAAACTACTTGACAAAGGATT
CCGCAAAGAGTTTTATGATGTCCCTGGACACTCAATTGAC
CAGCTATATAAACTTTACAAACGCAGACCAAGGGTTCAGA
GGATGAAAACACAGACTGAAAATAACCCATTTAAAGAAGG
GGCAGCACCATCTGATGGACTCTCTTTGATGATGAAGGCC
ATGGAGGAGTTGGACGCTCCAGAGCACATGCTGGAAGGTT
TAGATCCAGCTGTGTGGGAGAGGTTTTGCCTGGCAAGACG
GGCCAAAGTGGAAAGTGAACAAAAGGTCAAACTAAAGGCA
CTGACTTTGGCAGAAATGCAGGCCTTTCTTCAGAGGAGAA
TAGATGAGGATGACGAAGCTCAACTTGAAATAAAAAATCT
CATCGATGAGCTCAATGGGCTGTGTGATGAGAAGATGAGG
TTTCGACTGGACAGTATGGTGCAGATTGTTCTCCAGCAGG
GTCAGGTTGAGGTGGAGGCTGGAGAATTCATCGCTGACTA
TAGCAACGCATTGCTGATCCAACGTAAAGTTGTTGAGGAC
CTGAACAGCACTATCAGGGCTTTAGGAGATCAGAAAATCG
CCACTATGGTGGAGTGTAAAGATTTCCGTAAGGGAATCAT
CCAGCAGGAGTGGGAGCACAGGAGAATGAGGATGCAGCTG
GAAGATCTCAGCAACAAAGCCAGAAACATACAGACGCTGC
GCATCACTCAGGACATTCAAGATTACCTGAATGAAACAAA
TAATGACAACAGGGTGTCAAAGCAACTCACAACTCTTGAG
AGGACCTTAGATTTACAGAAAACGGCTCATCAAAAGAAAA
TTGAGATTTGCAAGAAACAGAAAAGGCAGCTGGACAGACA
AGTTGCAAAGATGCAGGAGAAGAACGCAGCCCTTGACTTG
AGAGTGGCAGAAATGGAGATAACGGTGGCAGAGAGGAGAA
ATTTTTACGAGGCTGCTGCAATGGAAGATAACCAGGAAAC
AGAGTCAGACAAGAACTACCAGGACATCCTCCTGAGAAAG
AAGCTGCTGGCCATCGCCAGAGCTCAGTCTGAAGAGCTGC
TCCTGCTGAGAGCGGAGCTGGAGAAACTGCGCATGAAGAA
CTTCCCGTCTCTCTCGCAACTGCACTACAACTGACTCTAC
ATACAAAACGCAACAACTTTACCTAAACAATAAACAACAC
ACAAAGGTGCAATAAATTATTATACAGTTCAATCAATTGA
CAATCTTTCTTCGCAAACGTTTTAATGAACAAAGCTCGCT
GCAATCTGTTTGAACTGTGAATAAAAATTGCTGAAATGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cfap43-201 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040775 (1),  Ensembl_Trans:ENSDART00000147713 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE319394 (1) 900 nt
GenBank:EE329193 (1) 855 nt
GenBank:DT055179 (1) 770 nt
GenBank:BM777651 (1) 680 nt
GenBank:EB934962 (1) 644 nt
GenBank:CO354835 (1) 583 nt
GenBank:CO355460 (1) 544 nt
GenBank:EB910456 (1) 481 nt
GenBank:BM316377 (1) 457 nt
GenBank:EB927424 (1) 217 nt
GenBank:EB915138 (1) 189 nt
CITATIONS (2)