Transcript

camsap2a-202

ID
ZDB-TSCRIPT-090929-2088
Name
camsap2a-202
Previous Names
  • camsap1l1-001
  • camsap2-001
  • camsap2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011841 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011841|OTTDARG00000010309|ZDB-GENE-030131-3016 camsap2a|OTTDARP00000010230 DKEY-39E8.1-001 LG_none BX950190.12,BX649292.16 Danio rerio protein_coding NOVEL, 4287 bp
ATGGGAGATCTGAGCGAGTCCAGAGACCCGAGAAAGACTT
TCATTGTTCCTGCCATCAAGCCTTTCGATCATTATGATTT
TACCAGAGCTAAAATCAGAGCCAGCCTCACATGGCTAGTG
GCCAAAGCCTTCGGTACAGACAGTGTTCCTGAAGAGCTGA
ACGAGCCCTTCTACAAGGACCAGTATGAGCAGGAGCACCT
GAAGCCTCCGGTGGCTGATCTGCTGCTGTCAGCGGAGCTC
TACTGCAGAGCTGGAAGTCTGATCCTGAAGAGCGACGCTG
TCAAACCTCTCCTGGGCCACGATGCGGTCATCCAGGCTCT
GGCGCAGAAGGGCCTTTACGTCACCGACCAGGAGAGACTT
GTGACTGAGAGAGACCTGCAGAAGAAACCTATTCAGATGA
GCGCCCACCTGGCCATGATCGACACTCTGATGATGGCGTA
TACAGTGGAGACGGTGAGCGTGGAGAAGGTGATGGCCTGC
ATGCACCAATACTCCACCGATTATCCAGACGGAGACGTGC
CCTACGACACAGAGGATGCCGTCACCAGCTGGATGAATGT
GAATGAATACTTGAAGGAAATCATAATGCAGGAGCAAAGG
CGGATGGAGGCGCAGAACGCAGAGCCTGTTGAGAATCCAG
CGCGTTACAGGAAGGAGCAGGTTCTGCCCAAGTGTTTACC
GTGGATCCCTCCGGTGGACAACCTGCTGAAGGACAGCACA
GATGGCTGTGCTCTCGCCGCCCTGCTGCACTTCTACTGCC
CCACCACCGTCAGCCACATTTGCCTGAACGAGACCATGTC
GCTGGCAGACAGTCTGTACAATCTCCAGCTCATCCAGGAC
TTCTGCAGGGAACAGCTGAACCACTGCTGCCACTTCAGTC
TGGAAGACATGCTCTACGCTCACTCTTCCATCAATAACTA
TCTTGTGTTTATGGCTGAGCTCTTCTGGTGGTTCGAGGTT
GTTAAGCCGCCATTCGTTCAGCCTCAGGTGTTGGACACTG
AAGCACCAGCCCCTTCACTGAAAGATCTGCCACCCGTGCC
CATCTCTAAAGTCACAAAGAGAAGTTTTATGGAAAGACCT
CCTAGTCCAGATAGACCAAGTCTCCCCCTTCGACCTCAAC
CACAGACTTCAGGCTCAAGTGAGATCAAGAGATCAACCTC
AATGTCATTTGTGGAGAGCTTCATGGGCACCTGGCCCAAG
GAGAAGAAATCTCCTGCTCAGGGAGTGTCCTTTGAAATCC
CATTTGATGAAGACAGTAACAACAAAACAACTACTGGCCG
AGGGATGACTCGGTCTGTCAGCACTGAAGGGTTTGGTTTC
AAGATGCCCCATGGAACCAGAGGCATAAAGAGAAACCTGT
CCTTTCAGCCTGTCAATGGCAAGAACATGGGCATTGAGGA
GGAAGGCTGTCCTGACACCCTGTCAGAAAATCATAACAGC
CGTCTAAATGGCTCAGGGCCACCTAGCATTGAAGAGGCCC
TTGAGATCATCCACAACTCAGAGAAAAAATCACAGAGCCC
CAGGGCCCATTTGCCCAGTGAAGGCTTCTTTCTTCACCTC
CAGAGTAAAAGTGAATTTAACCCCAAAGCAAAGGATAGTC
AGCTAGATTCAGTATCAGAATCATCCAAAGGGGTCGCTAG
CACGTCCACCACTGAAGTAGACACTGGCATTCATGTGCGG
ACAGAGGACATCCAAGAGACACTCGACGAGGACTCATCCC
TAAGGGATTGTACTGTCAGCATGGAGTTTGACATGGATCA
AGACTTTGAGGCGAGAGCTTCTCGTAGCCAGGGCTCTACA
AGCCCATGTCCCAGCAGCCTTAGTGCCAAGTCCCCTGCAG
GAAGTATCCCAACTCCTGCTTTTACACCTGGGATTAAGTT
GACCAGCTTTGCTGAGCAGAAATTACGCAAACTGAATCCG
AACACAGAAACCAAAAGTGCTCCTTTCCAAGGCACAACAC
CAGATGGGTCAGATCTCGCCATTCCTCACTCCGTCTCTTG
GGCTCCTTCTCCTGAAATCAGCCCTGCGCATCAACCGTCC
AAGGACCCAGCTCAGGCCATGGCTGCAGAAATGGTGCAGC
TGCGCATGAGACTGGAAGAGAAGCGTCGAGCCATTGAGGC
CCAAAAGAAGAAAGTGGAGGCAGCCTTTACCCGACACCGT
CAAAAGATGGGCCGCAGTGCTTTCCTCACAGTTGTCAAGA
GGAAAGGAGTAGATGGAGCGTCACCATTTCAAGAGGACAC
TCCCACCTCAGAGGAGAGCAAAACACCAGTGGGGACACCC
CAACCCGTCAAGTCTCCGCTGAAGTCTGCTGGTGAGGACG
GCACATCTGAGGCAGACCTGATGGAATACACACGCTCCAT
TGAGAAGCTCAATGCTTCTCTAAGCTTCCTGCAGACTGAG
ATGCAGCGACTGGCCCAACAGCAGGAGGTAATCATGCAGA
TGCGGGAGCAACAAGCTTGGGTTGTGTCACCACATCAGCC
TTCACCACAAAAGCAGGTACGAGAGCTCAGAGGGAGTGGG
GCGCGCTCTTCTGGGTCTCCCTCACCTGCAGATTCTCCTA
GAGCCACACACCGTTCCCCTACTAATCTAAAGAGGAAGTC
TGCCTCTTTCCACTCCAAGACACCAAGAACACCAAGACCC
AGTGAGCTAAAGATTGCTCCCTTTAATAGAGTTTTGACCG
TCCCACAGTCAGTAGACAGCATACCACGCCTAAGAAGATT
CTCCCCATCTCAGCCCATGTCCTGCTCATTTTCATATATG
GGAAACGAGAAGAAACCATTATCAACAGCTGACAAAGACA
TTGAACAAGGTCTTGAGGCATTGTCAATTGAATGTTCTTC
TGATACTATCACCTCCCCAACCAAAGAAACCCAACAGGCT
GTAACTGATGACACTGACCTGCATGCTAAAAAGGCAGAAG
ATGTAGAAGAGGAGAGCAGGAAGGACATCAAGCAAACAGA
AAAAAGGGAAAAGCTAAAGAAGCCAAAAACTGACATTAAG
CCTGCAGTAGAATCTACCGTTTCTGAGGTTTTGTCGCAGA
TTGTAATGGAGACCGTTATTGTCACTCCCACAGAGCCATT
TGACATTGCCCATCAGACCAATAAAAATCTGATTGAGGTC
CCACTTTCTGTTTTAAAACCACTGGAAGGAAAGGCATTAG
AAGAGGAAGTGGAGAAGGAGGCCTCTGGGGAAAATCAGGA
TGATGATCAGAAAGCGTGCTGTGGATTCTTCTTCAAGGAT
GATATGAAGGAAGAGGACAGCATGGCCTTGAAGCGAGCAG
CACTTCTGGAGAAAAGGCTGAGAAGAGAACGGGAAAGCCA
GCAGAGAAAACAGCAGCTGGAGGCTGAGCATGAGCAGAAG
AAAGAGGAGGCTAGGTTAAAAGCAGAGGAAGAACGCCTGA
AGAAAGAAGAAGAAAAGGCTCGGCGAGAATTTATAAAGCA
GGAATACTTGAGGAGGAAACAACTGAAACTGATGGAGGAC
ATGGACACGCTTGTCAAACCGCGGCCTACAGGAGCAAAGC
AAAGAAAACCACGGCCTAAGTCCATCCATAGAGATGTGAT
GGAGTCCCCTAGGACTCCTGTCAGGGCCACAGCAGGTTCA
CGACCTCGTGTTTTTTCAGTTTCTAGCCTGTCTCTGGCTT
CTCTTGGAGATAATGACAGCGTCAACTCCGATAAGAAAAC
ACCCAGTAGGCCTGACTCAGCAGACGGATGCCTGTCGCCC
ACCCGCAGCCGTAACGGAGAGAAAGACTGGGAGAACGGTT
CAACCACATCATCTCTGACATCCAACACTGAATACACTGG
TCCTAAATTATACAAAGAGCCCAGTGCAAAGTCCAACAAG
CATATAATTCAGAATGCTTTGGCACATTGCTGTTTGGCTG
GCAAAGTCAACGAGGGACAGAAAAACAAGATTTTGGAGGA
AATGGAGAAATCAGGGGCCAACAACTTCCTGATCCTGTTT
CGGGATTCCGGCTGCCAGTTTCGCTCTCTCTACATGTACT
GCCCCGAAGCAGAGGAGATCAACAAGTTGGCCGGCATTGG
TCCTAAAACCATCTCGCGCAAGATGATCGACGGCCTCTAC
AAGTACAACTCAGACAGGAAGCAGTTCAGCCAAATTCCAG
CCAAGACCATGTCGGCAAGCGTCGATGCCATAACCATCCA
CAGCCACCTGTGGCAGACCAAAAAACCAGGAACGCCCAAG
AAAGTAGCGGCTGTCAAGTCCTAGTGTTTCTCAGCATGGG
ACATACACTATCTCAATGCACTTGTTTGTACATACTCAAA
TCCTGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations