Transcript

ism1-202

ID
ZDB-TSCRIPT-090929-20843
Name
ism1-202
Previous Names
  • ism1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040738 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040738|OTTDARG00000029648|ZDB-GENE-050523-3 ism1|OTTDARP00000032557 ism1-001 LG_ CU633823.3 Danio rerio protein_coding KNOWN, 3903 bp
AACAATCTGAACGATTTTCCACCAAGTATCATATAAAAAA
TATTTCATGATTATGCATACATGCTTCATTTATTTAAGCA
ACTGGGTTTTAAGCACTCTGCACCTAATTATCCCTCTATA
ATCTGTAAATGGTGGGCTATTGTTTTAGGACTCACAGAAA
GTCTCTAGTGTGTGTGTGTTTATATTATGGGGCGATAAGG
CGCAATGCAGCACCTGTGGGTAATTAGGCCATTTGAGGTG
AGATTGAGTGAGCGGAGCTGCTAATGTCTCTAATCTCTCT
CAGTGTAAACAAACAGTGCTGGGCTCAGCCAGATGAAACC
AGTATTGTTTCCCTTGATCTCCATCTTCAAGGTCTCTTTC
GTGAACATATGGCTGGTTATAGAGGCGTAAAAGACGTCTA
GGTTGCAAATCGCACCTTTCAAATGTAAAGAAAAAGTAAG
CTTATATTCAGGTAGCCTTTTTTATATAGGATTATGAGGT
CCACGGTTACCATGTTTGCACCAATAACATTTAATTTAGG
TTGCTTTCTTTTGCTTATATGTTAAATAGAGTGTGACAAA
ATAAGAACACGATGAACAATCTGAACACGATGCAATTGAA
TACGTTAAATGTGATAAGTTACAATAAATAAATAAATCAG
CCTTCATTTACTTATCTACGACTATTTCCAAAGCATTTTC
ATTGTTCAGTTCTGTTGTTTTTTCCTGCTATGAATGTCAA
TGGTTGCTGGTTTCCAACATTCTTCAAAGTATCGGAATGG
AGATAGAGTTGTTGGTGTTTGTTACCATCTTGATTTTTTG
TTGATCAATCTATTTGATAAGCTCAGGACTGTGTAGCTAG
TTCGTTTGTCTTCTGAAGTGGTGTACAAGCACTAACCAAT
TTGAAAAAAAGGGTCCAACAGGTCAAAATACATCTGGTAG
TGACAATTGTTCTATTCATGTTTGGTTTTTAAAAAGGTTT
GTTTGTACAGTGTAAACAATGCTGGGTTCCACACAAAATG
TTTGTGCTGGGACAACACGAAGGAACTAAGGCATCCCCCC
CAAAAAAAAAACTCAAAATATGTGTTGTTTCAGCTCATTT
GAAATTAGTTTGGACAAACAGCAAATGTCATTTGAGTGTA
CGCACTGTGTTGTCAGAATGACCTCCATCCACATGTATCC
ATTAAAACGCTTAAAATTGCTGTATTGTTAGTCCAGGTCA
GTAGTTGACAAAGTCACTTTGTTAATAGTATTAATAATAT
TAATAATAATATTAATAATAATTAAATTAATAAATAAATA
TAAATGATAAATCAGTTTTTTATTTTTATTTATTTTATAT
ACACACTTCATCTTCACAGTCTGTAGACCAGCATTGCTAT
CGAAGGGATAATAAATGTACATTGTAAGTTGTTGTTTTCC
CAAGTCACTGTTTCATAGTTTACACAGATCTGATATGGCA
TCATGGTATCAAAATAAAAATTGCGCTTTACACAGTGTGC
GTTTTACTCAAAACCAGTGGTTAGTAAACAGTAAATGTAC
AACATAGTTTCAAGATTTTACTTCTAAATGGCGTACTATT
ATGATAATCTATATAATAATATCATCATTATAACATAAAA
TTGTGAGACTTTTTCTAGCCAACAAATAATGAATCTGAAG
ATTTTGAGCATGTTAATTGTTCTCGTCTGTATTTACGGAA
TCAAGCTAATAACCGAGATGAATTTCTGAATTTGTGACAA
CAGAGAGTCAAGAAGTGTACACAGAGGGATGATTCACTCG
GATCTGTTTTCTTGAACATTCATCTTTTCTAAGAATAATT
CAAATCCATGATTGTCTGTGGACCAACTGGAGGCTCACAA
TGAACTGAGCCAAAAGTTTGTCCTTTTAGTGGACTGCTGT
GAACTTTGCAAAAATAAAAAAAAGTGATAAAATGTAAATA
ACCATTGAGTAAGCAAAGTGACCGAATGCTAAAACGTGGC
TCCATAAGCAGAGACATGCTAATCTAATGGCTTTCTACTG
TTTCTGTTATGCAGAATAATGTGAATGCAGATAGCAGCTC
CTCAGTTCAGCTGGGGCCAGGTGACAGACAGACTCGGGTG
GCTCATATTCCAGCATCTCAGCCTTGGGCTCAGAGTCCCG
GGACAAGGGGCAGCCTGCAGCGAGACGGCCCTGGAGCTTT
CCTGCTGGACCTGCAGAACTTTCCTGATCTCTCCAAAGCA
GATATAAATGGGCAGAACCCCAATATACAGGTCACCATAG
AAGTGGTGGACAGTCTGGAAGGTTCTGAGCCAGAGAAGGG
AATGCGTAAAGAAAACAAGCCTGGCTGGGCAGCTCCTAAC
TGGAGGAACTGGTGGCAGCGTTCATCATCCTCGTCCTCAT
CTTCTGTGTCCACTCCGAAGGGGCCTGAGGAACAGGATTA
CCCCTACGAGAGCAACACAGAGGACAGCAACTTCCTCAAG
CCACTCGGAGACTGGGAGAGAAGAGTGAAGAGTGAAGCTG
GAGCGGGAAGCAGAACCCAGACTGAATACGACTACATAGA
CGGGGAAGGCGACTGGAGTGCTTGGTCTCCATGCAGTGTA
TCCTGTGGAAATGGTAACCAAAAGCGGACCAGATCGTGCG
GTTATGCCTGCACTGCCACAGAGTCACGGACATGTGACAT
GCCCAGCTGTCCAGGGATTGAAGATGCATTCAAGACGGCA
GCAACTGAAGTCAGTTTGCTCGCTGGCACTGAAGAGTTCA
ATGCAACAGAGCTGTTTGGAGTTGATACCGACAGCTGTGA
GCGTTGGATGAACTGCAAGAGTGAGTTTCTCAAGAAATAC
ATGAGCAAAGTAGCCACTGATCTACCCAGCTGCCCCTGCT
TTTACCCAACCGAGGTGGCCTACAGCACCGCAGACGTCCA
CGATGCCAACACCAAACGCAACTTCCGCTGGAAGGACGCC
AGCGGGCCAAAAGAGAAGCTGGAGATCTATAAACCCACAG
CCCGCTATTGCATCCGCTCCATGCTCACGCTGGAATCCAC
AACGTTGGCGGCCCAGCACTGCTGCTACGACGACAGCATG
AAACTCATCACCCGAGGCAAAGGAGCCGGTACGCCAAATC
TTATCAGCACCGAGTTCTCCGCTGACCTACACTACAAAGT
GGACATCCTACCCTGGATCATCTGCAAGGGGGACTGGAGC
CGCTACAACCACGCTCGACCCCCCAATAATGGACAGAAAT
GTGCAGAAAACCCTCAGGATGAGGACTACTATAAACAGTT
TGAAGAGGCCCGGGAGTTTTGAAAACTATGTACTTTCGAA
AAACAGAAGCAGAACTTGTGTTGAAAGCTGGCTGTGCGTT
TGAAGAGGACTTGCTATAAGAAACAGACAGCACTGTCAAC
AATGCGCAGAGATCTTCATATGGTCTCCCTCAAAACCTTG
GGTTCAAAAGTGGAAAATCCATCATGGTTCTCTTTGTATT
ATGTATATTATTTGGGGAATCTCTAAATTGTTTGAATTTT
TTAAGGAGTAAAGGGAAAGAATGAAAGGGAAGACATATCA
GGAAATCACCAATGCATCAATGAGCAACCAACAGCTAGAG
TTTCCCATATCTTTGCATGCTTGTATTACACTTAACATGC
AGTTGGAAACCCTTCTCCTCAGGACTCTCCAACAGGACAT
TGGATACAACATTCAGGTTCCTGTGTAAACATGCGTATAT
TTGTCTAGCTGAATGAAAAGAATTCCCATATAATGTCCTG
TTGTATCATGGTTCCGTTTTTACTAAGAACAAAACAGCCC
TGTGTAATCTTTGCAAAGTATTTATTAAGTCATAGTTATG
TGTCAGTGGTAGGGATTTGTGCATCTAGATGTATGGACAG
ATTTTGAGTGCTAAATAAAGAGACCATGTCACATTAAAGG
TCACCATCAAACGATTCTCAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations