ZFIN ID: ZDB-TSCRIPT-090929-20830
Transcript Name: si:dkey-76k16.6-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040723 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040723|OTTDARG00000029641|ZDB-GENE-090312-171 si:dkey-76k16.6|no_translation DKEY-76K16.6-002 LG_ BX005372.6 Danio rerio protein_coding NOVEL, 572 bp
AGTCGCTGCAGGTTTGAAAGCCTTTAATAAAAGTAGTTCA
TTTTGAAATAATAGTGCCGCTTGCAGAAACACGATTTACT
GTCCGTGTTGAAGAAACAGTCATTACAGTGCTCTGCAGAC
ATTAGTAAGCCTGCCGTTGTGTTGTGTCCAATGTATAATT
CATCTGTCCTGTATACATAAAGGCATATGGATCCATTGTG
CTGCGGAACAGAACAGGGCAGAGAGCTGATCCTGTTATCG
TGCTTGTTGACCAGTGGCCAGAGTTCAGAGTTTTACTCAT
TAAACCAGAATATCGTGAGGAGATTCTTTCAAAGACATGA
CTGTTTTCTCCAAAAACGATGATTACCTTAGAGACCTGCT
GGCACAGAGAGATGTCATTGACTGGAAGAAGTTCATTTGT
TTGGCTGCTGAGCTTAAGCATGAGAAAATTATGGAAGTTG
TGGCAGAAAACAGAGGTGTACCTGTGAAGAAAGAGGCAGT
GTGCCACATGTTGGTCCTACAAGATCTATCAAAACTTCCA
GCGTTTGATAGTTTATCACTGAAGATTTCCTCCCTCAATG
AGTCTCATCTTG

si:dkey-76k16.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-76k16.6-201 (1)    Ensembl 1412
ncRNA si:dkey-76k16.6-002 572
si:dkey-76k16.6-003 (1)    Ensembl 540
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-76k16.6-002 Contained in:
[BAC] DKEY-76K16 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000040723 (1),  Ensembl_Trans:ENSDART00000139518 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB859795 (1) 537 nt
GenBank:EB856577 (1) 524 nt
CITATIONS (2)