ZFIN ID: ZDB-TSCRIPT-090929-20793
Transcript Name: si:ch211-57f7.7-201
Previous Name: si:ch211-57f7.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040681 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040681|OTTDARG00000029616|ZDB-GENE-090313-119 si:ch211-57f7.7|OTTDARP00000032513 CH211-57F7.7-001 LG_none BX569782.7,BX890571.10 Danio rerio protein_coding NOVEL, 3569 bp
GTGAAATCTATCCTATCGTTAAGCTTATGAAATATAAATA
ATGTGATTAATTGAGGTATTAAGTTTTTTGATTATTGAAA
ACATGACATGACTGCTCCAGCAAAATGTTTATTAAAAATC
CTAAAATAAGTGAAAGCAGTAGGTTTAATTAATACAAAGT
CACATATGAAGTATATCATTTTAGTTATTATTAGAATACA
TTTAGTCTAATAAGGTTTTCTTTATGGTGTCGCTATCCTT
AATGGGTTATTTTGGTTATATTATGCGCTCCACACTTCAG
TCCAGAAGGTGGCAGGAATGCACCTTGTTTGTTTGCCAGC
TGCCATTAATCAAAAAATAAGACGAAGTAAGCTTGATTTT
ACCACGTTTCTGCATTTGACCACGATGAACAGTGATAGCG
CCAACCTTACAGATGCGATTAACATTTTGCGAAATGTTCT
TGCTTCGCCGACTATAATTAGATCCATATCTAATTCAGTG
GATTCAAATGCGTCCCCTTCAGCTGAACTTCAAACAGAAA
CAGAATCTGAATTGCGCAATTTGTTTCGGCCATCTCGCGC
TCAAAGCATCAGGCAATCAATGTCCGCCGGTGAAGGACCA
CGATACCATACTCGCCAGCAGTATGGCAATTGGCAGTCTC
GGTCCAGAAAAAGGCCCAGAGGACAATACCATCAAACTTT
CAACAAAGACGTAATCTTGTTGACCTCTCCTAATGATAAA
AATGTTGTTAAACAAAGGAAAAAACAGCGCTTGCATGAGA
TTGGACACATATTAAATGCTTTCGAATTTGAAAAAGCATG
GGACAGTACTATGGTTTTAAGAAGAATTAAAGAAGGCTTC
AAAGAGAAAGTGCCATTCGATGTAAGTTTGGAAATACTTA
TGGGATGTGGCAACAAGCTGATTAAACCACAGTTAACTGA
AGGTCAAGAACTAGATGGCCGAATTATTTTAAAGGTCTTC
AGGTTGAAGGCCTTGTATGTTAGACCCTCAAGACCACTAC
TCTTGACTGAAACAGACTGCTCTGATGACAGCTGCTTTGA
GGTTGACATGCCAGGTGAAAGTATCCACCAATCACCAGGA
ACTGCTTCTGATGAGAATATGAACACTGACTTCAATGACC
AATCTTCCACACAAAACTCTTCCTCCACCAGAGTTCAGTC
ATCCACAAGAACTCAATTCTCCACCAGTTTCAGCAGTGCA
CAGCCCTCCACAAGTTCCAGCGACACACAGCCTTTCACTA
GTTTTAGTGGTGTACAACCCTTCACCAGTTCCAGCAGTGT
GCTGCCCTCCACAAGTTCCAGTGGTACACAGGCCTCCACC
AGTTCCAGCAGTTTGCCGCCCTCCACCAATTCCCGCGGTT
TGCAGCCCTCCACCCTTTCCAGCGGTGCGCAACCCTCCAC
CAGTGGCCAGCTTTGCACTAGACGTAACGCACCAGCTCAA
TCCTGGAACACGGACCAGTCCTTTAGATCTGCTTCCTGGG
ATGGTGATTATGATACCTACATTTCCCTCCTCCGGGGAAC
GTCTGAAGATGAGGAAGAAGATGAAGATCTTTGCTGCGCT
ATAATGGCCAGCATTGAGGACCAGATATTTCCCCCAGCAG
TTGAAATCCCAATAAAGGAAATACTGGAGGAACTTGCATC
AAAAATAAATGGCAACCAAACCTGCAAGTTTAATATTAAT
CGTGCATCTGTGTTGGATGGTGCTATACGGGGATTTACGC
GAATGTCCTACAGTCCAAATAACAGAATGGTCATTAGGTT
CTCCGACGATAAAGGAAAGTTTGAAGAGGCTGTTGACTTG
GGCGGCCCTAGACGAGAATTTCTACGACTCCTCCTGGTGG
CACTAATGGAGTCATCAATGTTTGATGGAAAAGAGGGCAG
TATAAACTTGGCACTTGATTCACAAGCCATGAGGGAGGAC
AGATATTTCATTGCAGGGAGAGCAGTTGCAGTCAGTCTTG
TGCATGGAGGACCTGCACCTGGTTGTTTTTCAAAAACGCT
ATATGACAGTTTAGTTCAGGGACCAGACATGTGCAGACCT
GGCTTGGAGGATGTAGCTGACCCTGAGATTTATAGTAAAA
TAAAAAAGCTTTCTGAAGCCTCAACTGTGGAAGAGCTACG
AGAGTCAACTGAGCCCATCATGGACTTCCTAGCCAATGCT
GGTTGTCTTAGACCTATAAAGAACATTGATGACAAGGACA
GGCTAGTTGAAGATCTGCTTATGTTTCAAGTGGTGAATCG
TGTCCGTGGACCATTTGAAAGGTTCAGAGATGGCCTGAAA
ACACTTGGTGTCCTTGCTAAAGTCCAACAACACCCGGAAT
CGTTTAGGTCCTTGTTTTGTCACCAGCCAAAGCAGCTGAC
TGCAGACATGATGGATGACCTGTTTGAAATACAGTGGTCA
GAAATTGGGAGCAACAAACGGGCTAATGAGAACAGGGTAA
TTGCCTTTTGGAGGGACTACCTGCAGGATGTAGAAGAGGA
AGGAGCACAGAGGCTTGGCGCGATCTTATCCTTTACCACT
GGATCAGATCATGTCCCACCAATTGGATTTCATCCCCAGC
CTTCCATTGCCTTTCACCATGACTCTGAACTTCTACAAAG
ATTTCCAATAGCCAATACTTGCATTAACTGCCTTCGCCTG
CCTTTATATAGCACCTATGGTGCTTTTAAAAGCAACATGG
AATTTGCTATCAACAATACACATGGATTTGGCAAGGAGTA
AGAGAGACTTAAATGCCAAGATGTTAATATTAAGCCAGGG
TTCTTATTGAAGCAATAGATTGCAAGAGATGGTTCACCCA
AAAATGTAAATCTACTCACTATTTATTCACCACCAAGTGG
TTCCAACCGTGTTTGACTTACTTTCCTTTGTTAAACATTA
AATAAACTAATTTGAAGAACTAGACTTGTAACTATTAACT
TCAAAAGTAGTTTTTAAGTGGTTTCAGGTTTTCAGTATTT
TTTAAAATATAACTTTGTTTGGCAAAACAAATTAAGTAAA
CATTTTGAATAAGTGAAGGATAATTAAATAATGGCAGTTT
TCATTTTTGAGTGTACTGTCCCTTTAATAATTTTCAGCAA
TGTTACAATTAATCTTAGCAGTTCATGTTTCAACATTAAA
GGGCTAGTTTATATACAAATAATTGTCATTTACTCTTTAC
TCTTCACTTTTCAAACCCGTTTGAGTTTCTTTGGTTAAAG
GGTTTAGCTTTATTCAAAATGTTTTTTGTTCAATAGAAAA
AAAAAATCTCAAAGGTATAGAGCCAATTGAGGGTGTGTAA
AAAGTGATAAACTATCCCTTTAACTAGGAATTAACATTTT
CAACCTTTATGCTAACATGTTAATGTGCCAGTGTTCTTGA
GGCATTTGTTTAACTCATTGTTAGGAAGTTTTCATCATTT
TTGATCAATCCTAACATTACTTTTTTTAACTGATGTTTTC
CATGTTTTTACAAGCATTTGTGTAATACATTTGTAAATGC
ATGTTTATGGATTAATTACATAACATTTGCTGTGTAGTAA
ATAAAGCATTTGCAGGAATAAATTGCAATAAACACTTGCA
TTACAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-57f7.7-201 Contained in:
[BAC] CH211-57F7 (1), CH211-194H13 (1)

Genome Resources: Vega_Trans:OTTDART00000040681 (1),  Ensembl_Trans:ENSDART00000135186 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI891105 (1) 587 nt
CITATIONS (2)