ZFIN ID: ZDB-TSCRIPT-090929-2069
Transcript Name: foxq2-201
Previous Name: foxq2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011784 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011784|OTTDARG00000010259|ZDB-GENE-050208-663 foxq2|OTTDARP00000010177 foxq2-001 LG_ BX088720.8 Danio rerio protein_coding KNOWN, 957 bp
AGCACTTCTCAAAAGACAAAACGCACTAGGAAAACCGCAC
AAAATGTTATGAACTTGGATCCAAAAACTGAACTTTCAGC
CACAAAGATCTCTAACAACACAAAAATGGAGGACAACGTG
TGCCACAGCAATCGAGAACAACTTGGACTTCAGTTTACGA
TTGACTATTTATTGTACAATAAGGGACGCAGCACTGGAAG
AGCAGAACCAGAGGACAATGTCAATCCATCAGAAGATCTT
CAAAGCACAGTAAACGAACCTGAACAAAAAACTCTCTCAG
AACAGGACAGTGAAAAATCAGAAGAGCAGGAAAACGACGA
GGATCACGAGAACACACATGTAAAGAGCGAAGGAACAGAC
GAGAAGCCAGCGCAGTCCTACATTGCCCTCATTTCCATGG
CCATCCTGGATTCAGACGAAAAAAAGCTCCTGCTATGTGA
CATTTACCAGTGGATCATGGATCACTATCCTTACTTCAAA
AGCAAGGACAAGAACTGGAGAAACAGCGTCAGACACAATC
TGTCTTTAAACGAGTGCTTCATCAAAGCTGGTCGCAGTGA
CAATGGCAAGGGTCATTTCTGGGCAATTCACCCGGCCAAC
TTTCAAGACTTCTCAAACGGGGACTACCATCGGCGGAGAG
CTCGGAGAAGGATCCGCAGGGTAACAGGGCAGCTGCCCTA
CGCTCTGCCTGCACATTACCAAACCCTGGGCCGCCTGAAA
CGGACACCGTGCTGGTGTTGCCCACCGTCCCATCCGTTAT
TGTGCTTCCCGCCTAGAGTCTACTGGAGCTGGGCTGCACT
TCAGACACAACGCACACCGGCCCTTCATGGACTCATATAA
CAAGATCTGCTCTGAAATTATTTCTGCATGTGCTGGAAAT
GAATTTGTACATATATTTAAGCCATATTTTAAATATGCAC
ATTTGTTTGTAAAATGAAAACCAATAAATATAGATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxq2-201 Contained in:
[BAC] CH211-195M2 (1)

Genome Resources: Vega_Trans:OTTDART00000011784 (1),  Ensembl_Trans:ENSDART00000136744 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC151982 (1) 981 nt
GenBank:EH998071 (1) 823 nt
CITATIONS (2)