ZFIN ID: ZDB-TSCRIPT-090929-2068
Transcript Name: zbtb7a-202
Previous Names: zbtb7a-001, si:ch211-195m2.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011783 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011783|OTTDARG00000010258|ZDB-GENE-050208-583 zbtb7a|OTTDARP00000010176 CH211-195M2.8-001 LG_none BX908727.6,BX088720.8 Danio rerio protein_coding NOVEL, 1745 bp
GTGCAGGCGAGATAGAAGAAGGACCAGTAGGCATCCCTTT
CCCTGAGCACAGTGCTGACCTGCTGGGCAGTCTTAACAGG
CAACGGCTAAGTGGGCTGTTGTGTGATGTGCTTCTAGTGG
CTCAAGAAACAGAATTCCCTGCCCACCGCTCTGTGTTGGC
CTCTTGCAGCACCTACTTCCACAATCTTTTCACCTCGGGT
CCGGCTGCTGACCGTCAGAAAGTCTATGAGCTGGACTTTG
TGCGGCCTGAGGCGCTGGCCGCTCTCTTGGACTTTGCCTA
CACAGCCACACTTACAGTCAGCCGCAACAGTGTGGTTGAC
ATTTTAAGCGCCGCCCATGTGCTGGAGATCTCACCCGTCC
AAGACGTCTGCACACACCTGCTGGACACCAAAGTGCTCTC
CCCGCCGGCGGGCAATGAGCAAGAAGACAATGAGGAAGAG
GAGGAGCGAGGAAAAAATGGAAAGGAGCAGGGCATCCGGC
TGCGTGCCCGAGAATACTTGGAGTTCTTCCAGAGGGGGGC
GCATTGGGGTAGCAGCTGCAGCACGCCAGAGCTCAGGGAC
CTGCCCGCACACCTGCACTTTAGCCAACGCAATGGCGCTG
ACAGAAATGGCATACCCATCGGCCCTGCTGACTACTACTC
CCCACTGGCCCAGGCCCTTTCACAGCCGCCTCGTGACCCC
GAAGACGAAAATGTGGATGAGGAGAGCCAGGATGTAGCTC
GAGCTCGAGAAAAAGTTGCAGAGGGTCTGATGCCCTTTTT
TGCTCCCACTCAGAATGGACATTACTACCTCCATCAGGCA
GACCCCAAATCCGAGAGAGAAGTGGAGGTGACGGGTGACA
GGGAGCATAACCAAGGCCCCGCCAGTGCTTTGCTACAACA
GATGATGGACTCCTTGGAGCGGAAAAGGGAACGGGGCACA
ACAGGTGGTGGGGGTGAGGACGATGGGCCTGAGGGTGATG
AGCCAGACGTGGAGTTTTACTTGAAGTACTTTAGTGCGCA
GCCCGAGGGGCCCACCAGTGCTCCCATATCTCCAAGTCTG
GCACCACTGTGGCCAGTCAGGGGCAATGGAGGTGGAAACC
AAGCAACTGGAGGGGGCAACAGTGGTGAAAGGAAAATGCG
ATCCAAGGCCTTTCAAAAGTGCCCCATCTGCTCTAAGGTC
ATCCAAGGTGCAGGCAAGCTTCCACGCCACATCCGTACAC
ACACAGGAGAAAAGCCCTATGAGTGTGCGATATGCAAAGT
GCGATTCACCAGGCAGGACAAACTAAAGGTTCACATGCGC
AAGCATACGGGAGAGAAGCCTTATTTGTGTACTCAGTGTG
GTGCCGCCTTTGCCCACAACTATGACCTGAAGAATCACAT
GCGTGTGCACACAGGCCTGCGCCCCTACCAGTGCTCCAGC
TGTTTTAAAACCTTTGTGCGCTCGGACCACCTCCACCGCC
ATCTCAAGAAAGACGGATGCAATGGAATTCCCTCCAGACG
AGGCCGCAAGCCACGCATTCGAGATTCTGAGCTTCTTGAA
GGTTCTCTGGAACTTCATGGCCCGGAAACAGACATCGAAA
GAGGTCGACGGCATCCGGACAGGGGCACCATTAGTCACCA
TCAGTCACCATCAGTCATGGAGGAGAATCATGGTAGTCAC
ACGCACAGTCCTGTTGCCGATGGGGAAGGTAGTGAAGTTT
TGACCTCGGGACAAGTGGACCCCACAACTACATGAATAAG
ACTTTGTCAGAGAGGGCTTTACTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zbtb7a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000011783 (1),  Ensembl_Trans:ENSDART00000140187 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BG303531 (1) 639 nt
CITATIONS (2)