ZFIN ID: ZDB-TSCRIPT-090929-2061
Transcript Name: atp8b3-202
Previous Names: atp8b3-001, si:ch211-195m2.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011762 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011762|OTTDARG00000010241|ZDB-GENE-050208-424 atp8b3|OTTDARP00000010155 CH211-195M2.2-001 LG_ BX088720.8 Danio rerio protein_coding NOVEL, 9910 bp
AAAACGCAAAATTCCTTGACTCGTAACTTTCTCTTATCCA
TTGCCTTCACTCCCGTCTTTTTCCCTCTGCTCATCTGATT
TTGCCACCTGTGCTGCTGCTCCATATCGAGTTCCAGTCCC
TCCTCCGTGCAGCGCATTTGCACAAATTCCCCAGCCGTGC
ATCAGAGAGGGAGGAGAAGGGAGGAGAGACCAGATTTAAA
GAGGAGTTTACACTTTAACAACATGTAGAAATAAACAGAA
GAATCATGGTTCAACAAGTGCGCTAACATTCACGTTAAAC
TCGGGCGCGAGGAGCCGTGATTTACCCGGATGAGACGCTG
GAGAGCAGAAGCACGGAAAGTGAGTCCTGTGGGAACTGCT
ATCAGGGAACAAAAACTGTAAGCAGAACAGTCTGTACAAT
ACTTCATCATGACTGGTAGCACAACTGAGAATGGAATCAA
ATGGGAGGTTCGAGCCAATGGGCGTGATTTTCATCAGTCG
TGCCGCCGCAGATCTGTCCTATGTATCCGCTGGGGCCGCT
ATGCGGATAATGTGGTGCGGAGCTATAAATACACCCCTTT
GACCTTTTTTCCCCTAAATCTGTATGAGCAATTCCAGCGA
GCAGCGAATCTCTTTTTCCTGCTCATTGTGATCTTGCAGT
GTGTTCCTGTAATTGCGACCATCCCATGGTATACCACAAT
GCTTCCTTTGCTGATTGTTCTGTTTGTTCGCGGGTGTAAA
GATCTGGCCACTGACGTGGGCCGACGACGTAGCGATGCGC
AAATTAACCGGCGCCCCTGTGACATTCTCACTCCTGAGGG
ATTCAAAACAGTTAAATGGAAAGATGTTTGTGTAGGTGAC
ATTCTCCGAGTTCATAAGGACCAGGTCATTCCTGCTGATC
TGCTCCTACTTTGCAGCACTGAACCATACAGTCTTTGCTA
CGTAGAAACGGCAGACATCGATGGAGAAACCAACTTGAAA
TTCCGCCAGGCTTTGACTGTTACTCATACTGAGCTGAATG
GAGATTCTACTGAGCAAAACCTGGCAGCATTTGATGCTAT
TGTGCGATGTGAAGAACCAAATGGTAACCTGCATTCGTTC
AGAGGCGAGTTTCATTGGAAGGGAGAGCGCCACCTTCTGG
GCACTGATCACCTGCTGCTCCGAGGAACTGTACTGCGAAA
CACAGACTATGCCTATGGACTGACCATATACACAGGCTCA
GATAGTAAAATACTTCAAAACTGTGGACGTCTAAAACTGA
AGAAAACCCATGTGGAAATACTGCTTAACAAAACCGTATT
GGTGATTCTGCTCTTCATGCTGACCACAGCTCTCCTCCTG
GCCATTGGCGCTGGGATTTTCGAGTACAGGATTTCTCCGA
ATTATGATGTTGTCTCCATTGTACAACGCGACTCGTCTCC
TGCCTATCAGGGCTTCCTAACATTTTGGGGCTACATCATT
TTACTGAGTCCCTCTATGCCCATGTCTCTCTATATCACGT
TTGAAGTGATCCACATGGTGCACTGTCTTCTGATTGGCTG
GGATGTTGAGATGTATTGGGAGGACACCAACTGCCCTGCT
CATGCTCGAACAACCACCCTAAATGAGGAGCTGGGTCAGG
TGGGCCACCTCCTCAGCGACAAAACTGGCACACTAACGCA
AAACCGCCTGCTTTTTCGCCAGTGCTTCATCGCTGGACAT
ATTTATGTTTTCTACAAGCCTTTGGACTTGAGCTGGAACC
GGTTCTCCTGTGGTGGATTGAAGTTTTCTGACCAGCGCTT
GGTGGACAAGCTGCGCGGAAGAGGCAGCCTTGAGTGCCAA
GAGTTTTTCACCGCTTTGGCCCTTTGCCACACTGTCATGA
GCGAGTGGAAGGATGGTTTACCTCACTACCAGGCTGCGTC
ACCAGATGAAGAAGCTCTGGTTTGTGCAGCTCGAGAGCTG
GGCTGGGTGTTCCTCTCCCGGACACGTGACACTCTCACCA
TCAGCGAGATGGGCCTCACTCGAAACTATCAGCTCCTGGC
CCTTCTAGACTTCACCAGCAAGAGAAGACGCATGTCAGTG
CTGGTGCGTAGCCCTGGAGGACAGTTAAAGCTGTACAGTA
AGGGTGCAGATATCGTCATTCTGGAGAGGCTTCAGAAGGA
CTGGCCGCTTCAGGAGAGCACAGACAGAGCTCTAGAGCTG
TTTGCTCAGAGCTGTCTGAGGACTTTGTGTGTGGCGGTGC
GCCCGGTTCCTGAAGCCCTGTGGACGGAGTGGAGCCGAGC
TCTCAATCTGGCGGGCACAGCCACGGGTAACCAGGAGACG
TTGCTGGAAGAGATATATGATCAAATGGAAAAAGACTTAA
TGCTGTTGGGGGTGACCGCCATTGAGGATCGCCTTCAGGA
AGGTGTGCCTGAGACCATTGCCTCTCTGCGGCGAGCAGGC
GTGAAGGTGTGGGTGCTGACAGGAGACAAAACAGAAACTG
CTGTGAATGTGGGATATGCATGCAAACTGATGGATCCAGA
CACAACTCTCATTCAAGGGGAGGAGCTTAGTGATGAGCAA
AGCTGCGCTAGTCATCTCAGGTCCAGAACTGAATTAACCA
AATCGTCGGAATGGGGGGCAAAGTTTGTTGCTCTATCTGG
CCAGTGCCAGTCTGTGCTGTGCTGCCGCGTTACTCCAGCT
CAAAAGGCCGAAGTGGTCGAGATGGTCAGGAAGCATTCTG
CTTCAATTACAATGGCAATAGGAGATGGCGCCAATGACGT
CAACATGATTAAGACGGCTCATATTGGCGTGGGTCTTTGT
GGCGTGGAGGGAAGTCAGGCGGTGCTGAATGCAGATTTTG
CTCTGGCGCAGTTCAGTTTTCTCCGCAAGCTTCTGCTGGT
GCACGGCCACTGGTCATACTACCGCATCAGCATCCTTCTG
CGCTATTTTCTCTACAAAACCACAGCTTTTGCTTTGGTGC
ACACATGGTACAGTTTCTACAATGGCTTCAGCGCTCAGCC
CATGTATGAGAGCTGGTATATTAGCCTCTTCACAACAACA
TACACATCGCTGCCTATACAGTGCACAGGGATTTTTGAAC
AGGACATAAGTGCTAGGAGTTGTCTGTGCTGGCCAGAGAT
CTACTCGATTGGACAGAAGAAGCAGCTGTTCAATCCTTCA
GTTTTGGCATCCACACTTCTTTACTCCTTCTACTCCTCCA
TCATCTTTTTCTTCGTCCCTATGGGAATCTTGCAGTACTC
TGCTCTCGATTTCCAGACTTTAGCCATTACTATTGAGACA
TCTGTGCTGTTCGCAACCACTTTGGAGGTTATTCTTTGCA
CTAAATACTGGACCAAGTGGAACGTTGCAGCAGTCATTTT
TAGTCTAGCAGCGTTCTTTCTGTCCACACTGGCTCTCCAT
AGCACTCGCCTGTTCACCGCCTCACCTAAAGACTACTTCT
TCCTAGGAGCATCGCAAAATGCTTACAGCACTCCTGAGGT
TTGGCTGACCATATTTGTGACCACCTGTGTTGCAGTCCTT
CCCTCAATAACAACACGAGCCTTGGCGAATGAACCCGTAG
AGCTTCAGTCGTGGTTTCAAAGAGGTACTGTTCAGCGTCG
ATCATCCTACGCTGTTTCCCAAGGGAAAGGTTTCGGAAAG
TTAATTACCACAGGAGTTGGTCTTCCCTCAGCAGCGCCTC
GACAGGATGGGAGAGTTACAGCAGAAAGCCTGAAGAATGA
ATCTCCACAGGGTTTACACATAGAAATGAATAGTGCTGGT
GTGTCATGCTAGCATCTTTAGTCATGACAGGATTGGGATT
AGCGAATGTAGCATCAAGAATCTGTGCTAAACAATCATTG
TTTATATATATATATATATATATATATATATATATATATA
TATATATATATATATATATATATATATATATATATATATA
TATATATAAACCCACTGATAGGGAACTTTTTGTCAATATA
AATTTTTATATGCATTTTTTTTTTTATTAAAATACAAATA
AGTAAAGCCAGTTTTGTGATTTTAGATAAATAAAATAAAA
ATTACAATAAATAAATACAATACAATTTAATCAAAAATCT
ATTATTTTACTCTTTATTGCTGCAAACAAATCCAGGCTAG
GTAAATAAAGAGACTGTAGCATGAAAATGTTCAACAATGG
TTGTATTTTATTTCAAAACACGCAAATTACCCATATTTCC
TTATTATTTTTTTTCCTGTAACAGTTATTACTCCAATTTG
TCTCCTTCTGAAGAGTGTCCACTTGCACTAAATGAAAAGT
GCTCCACAGGCTCTCTGGCTCCCCCTGTAGGACAGAAAGA
GGAACGAGGCTCTCCTTGATGATGTGCCCTTTAACCTTTA
ACAGCTGCCTGAGAACAAGTTTTTGTGTGCATGTGAAGCT
TCACTGGATACTAAAACTGGAAAATTCTTGTGCATAAGAT
TTTGATCACAAACAGGCCATCTTTCTTTACTGGGCCTTGA
TTTTCAACTTGAATGCAAAAGTTCAGCTGGAGCATATCTA
CAGCTTCAGAAACACACATTGATTGGTTGTTTGGATTGTC
TTTACCCTTTTATCAGTCTTTGGCTTGGGTAGATGTGCTC
TAAGGAGAGTTTCTGTACATGTAAATGGGTCTTGCTTACA
CTCTTCCCTGAAAACTGTTAAATTAACCCAGGTTTATTTG
CTAAACTGCATACATTTCCTGTGTTTAGTGTGGTTTGCTG
ATCTTAGCTAGGATAGCTAATCAACTTGTTGATCTTCCAA
CGCCTATATAAAAAAACAACATACCAGATTGGCTAATCCC
AGCAAACCAGTTCAGTTTAGTGCAACATTTCAACATTTTC
TGCCACTCTGTAATTGGTGCAGGTATCCTTGAACATCATC
CTGGTTGTTGAAGTGGAGTTAGGGAAAACTGAAAAGCAGC
CTGAACCAGCAACATCAATTCGGATTGAGGTAACGGTTTT
GCTTTTCTCTGGATTTTTGCATAGTTTTCTGTGCAAAGAC
AACCAGTCTCATCAGTTCTTTATTGACTGGTTTGTGGTTA
TTAGAGAGCATTATTAGCCCAAACATTAGCACTTGACTGT
GCTAGCTCTTTTCAATTGGTTTAGTATCTCGCTAGATGCT
GATAGTTGACATTACAATTACTCTCTGAATATTTTTGGTA
GATAAAATTATAACAAAATTAGAAAGACTTGAATGTTTTC
TATGGATTGCATTTAAAATAACAGGGAAGAGTGTTTGCGG
AGTCAGCACACCATAAGCACCACAGCAAGCTAAATAGGGC
AGTGGTCGCCTACTTGCGACAAACGAGAGCCTCTTTCCTC
CTTCCTTTCTCCTCTTCTCAGCCTGTCTTCTCTCTACCAT
TTTATTTTCTCCTTGTTTTGAAACTGATTGTCTTCTACCA
TCACAAAGACACTTGGTTCTGATTGATTGACAGGAAACAG
AAGAGGAAGAGCACAGTGTGACTGGGGGGGGGGGGGTTGG
ATCTGCAAACAGACCCGGAGAGAAACGTGATGTACATGAT
GCTGTTTTACAGTCGATGAGAGACCATTTCTGGTTGGAGG
GGTCTGTTGCAAAAAACTGGCTGGTAGCATTCCAGTTTTG
CATGAAATGGCGTGCAACCCAAATTGAGAAACACTCCACG
TGTAAACAAATGCACACAAGATTACATTTTTAGAAGAGAC
GTGTACATTGGGTCCATGACCAAATTCAGTTGCCCAGGAT
ACACGGTCATGCCCCGTTATTAAGAGTAATATACATAAAA
GAAATACAAGGAGGGCAGAGAGAGAGCTGCAACAATACAT
GCACACAACCAGTGAAAAACAACAGTGACAGAAAACTCTA
CAAAATAAAGACCCCTCCAACACCTTTACCACCCTTCCCA
CCCATCTCCAACCTCCCCCGGGGTCTGTTCATCCTAGTCG
CACCCACCAAAGTCCAGGTCGATCCAGCTTTACTCTATAC
AGTATACAATTACTCATGCAGAAAAAAAGTGTCCCCGCCA
CTTTAAATGGGAGGAGTTTGTTTTTTCATTTGTCTTTTAA
ATTAATGCTAGGAGCACTTAACACAATCAGGTTAGCTTTA
AATAAAGAGGAAAGAAATTGAAATAGTTACAGTTTAAATA
ATGCTGAAACTGAAATGATTAGGACAAAAATCGATGCATA
TATTGGAAATTCTGCGCAATGTGATTTCGCTCTTTCAGTT
TTCCTTTTCCTTCATGTCATGTCTTTCATTAGAAACATTC
AAATGTCTTTCTTTTATAAAGAATTACATACCACAATTGA
TCAAAAAATAAAATAAAATAAAACAATTGGCAAATGAGTG
AACTGAACAACACCAACAAAAACACAATTTAACAGTATAA
AGCTTCAAGTCACAAGTTCAAAAACTAACTATTATTAGTC
TTAGTAGTGTTAGTGTACTCATTGTAATTAACATTAGTGT
AATCTAAATTACATAAACTTTACACAAAACATTTGAGGTA
TTTCAGAATCAATTGTCAACACCTTCCTGCCAAGTCTGTG
TGGTTTCCAATGGGAGAAATATAAGAGGGAAATGGTTCAA
TGCTTTTTGTGAAATGGCCGTTTTTCCTAAATCACTTAAA
CATTTCATTCAAAATCTGTTCAGCACCGTAATCAATGTAA
AATGTTCATTTTAGCAAACCACGTTCCTCAATTAGTGCTC
ATGAAAACAGGCCACATGTGGGTACAGCACTGAGGCATAT
TGAGGGAAATCAGGGTGTGTATAGCATTGATCATGCTAGC
TAATATAAAATAATATTTTGCGAATATTCGCCAGTGCATA
CAGTAAACTGGCATCCCTCTATTATTAGACAAGCCTAATA
TGAAGGTACTTCTGATTTTGTACGAGCTCTGAGCGCAAAT
AATGCAGTGACAATGGAGGAATAATAAATAAGGTCATTAA
AGTGCTTAAACACCAGTTTAATATCAAACTAAAGTTAAAT
CACACCCTGCTTCAATATCTATATGCCTATGCGCTGTACA
TTCGTATTTTGAGTGAATGTGTGAACGCGAGCTTGTGGTT
AAATGTGACAAGAATGGGAGTAAACGCAAGAGTTAATACG
CATACTCAAAATTATGATGCTGCCCCTTTAACTAAAATGC
CGTGAAACCCGTCAACGGTCAAACGCGTAAGTGTAACCCA
TGTTTATGCAGAGAAAACTCCTAGAAAGCAGCTCCGGTTT
GTGTATAAACTTAATATGTGTAAGTGTGCTGCGTGTTGTT
GTGTGTTCCAGTGCAGTCCCACCCGTTGTTGAAGGAAAAA
GGCACTCAACTCAACCTGCATAGCAGCCGTATCCCTCATT
GCGGTGCTATGCAGTCTGACTGCACTGTGAGATTATGTAT
ATGTCAGCATATGCGTAACGATCCGTTTGTAAGTATGTAT
GCATCTGTAACAGCTTTGGTTTTGCTATTGGGCTTTTGGT
TTGTGTGTGTATTCCTCCCTTTGGCAGCACAGGACTGGCA
GGTCAAAGAATCTTTGGTATCAGTGGCTGTTTCACAAACC
ACCCAGCTCAGTGAGGTAGCCACACTGGTTCTCACTACAA
ACAAAAGGTCTGTTTTATCAGCTAATGTACATATAGATGC
CCACTGATTTGTGTTGCACAAATCGGCTGTCTCTTAATGC
TCATAACCAGGCCCACATGGATTCTGTGCGCAGAAATCCT
GTCTTTCACACAGTCTGTTGTCCCACTCATACGTTTTGGC
AAATTTGATGATTATGCTTTCAGCTACATATTGGACCATG
TTGGAATTTACTCAACAGAATACCGCTGACTCCTGAAAAT
TCTGCAGATTCTTTGTGGGTCTGCTTATAACTCAATGCTC
AGAGCATAGTTGAATTAACAGTGCTCACTTTCATCTGTTC
AGCAAGTCCTGCAACATTTCCAGAAAATGCTACTGTTGCA
TTCAAATGTACTAAAAGAAGACTCCTCTAAGATTTTAACA
TCTCCCTATGGAGGTAAGCTTGTGCCCTTGTTTCGCACCC
ATTTTGGCAGGGTTTTTGAGGATGTTAAGAGGAATTTTGG
GTGGAAATCTCGTTTTTGGTTTACTTTTCAACAGAGTTAC
ATCTCCTTTGTGGTCAGTTAAAGTTCCTTCTGTTATGACC
TGTGGTAGTTCACATGCAATGCAGAGATGTCCAGTTTCAG
TCCTCTCAAGTTTTGTTATTCTTTTAGAAAGTCTTTTTTT
ATGATTTTTTCACATGATCAACAAGGTGCCTTACATTTGC
ACGGATCATATATTTAATAAGAAATAGAAATACTTTTGTA
CCAATTACCCGCTTTAATATTATGAAGAGAAAGCAAGTGG
GAGACATTAAGAGAAAAATAAGGGATTAAGAGTTAAAGAG
GAGAAGGAACAGAAATATTTTAGTATTTTTTTCTGTTCTT
GTTGTGTTGCTGCAGAGCGATTTCTAGCTTTTCATTTAGT
TTTATTATAGACTAGCTGTAGTGAATGATTTAAAGCATTG
ATTATTTTCATAATTAAAAAAGATTCTGTTTCTTTTTAAA
ATATGATTGTTGGTTGCTATGGCACGTAATGCCGGTTTGG
AAGTGGACTCTGGCTGAGGGTGTGTGAACTTCTATTTTAT
ATTAAGGCAAACATTATTGGCACTAGATTTTATGTAACAT
TTTGCACTATGTTTACCCCTTGTCCACTTTTCAGGATAAA
CATAACATTTTGATTTGTCAGTAATATTTCAGTTGTGTAT
GGATGTACCATTTTGTAACAAAAATTCCCATTTGTATTTA
AAATGTGCCTTTCGTTGTGTTTGGCTGTACCTGTCTTGAC
CTTATTGTGGATCTATACGGAATGAAAAATATTCTTTTTG
TATTTGAAATGTCAGAGATTACAGTCTCTTGAGATTAGAA
AGGGTGCACCGTTGCTGAAAATGGTCCAGTATTTTGCCCC
CAAATAGTGGTTGACTGATTCACTTGCATTAAAGAGAGTT
CGGATTGTGATAACATGCGTTAACCACAAGTGCCATAAAA
TGTTACAGCCCAGGTAACACTCCATTTCCATCTGTGCAAA
ATAAACCGAATGGAGAGCCATGCTGGGCGAACATGGTAGT
CCTTGTTGTGGGAGCTCGTTCCATTTCACCTTCAGTAGAG
GTCGACGTCCTTTGCTTTTCTGTCTGTATCGATTAGTCTC
TCAATTCATTAGCTTAGCATATGATCTGAGAGCCTCTGTG
AAACAACTGGCCATTAGGGAATTGTGCCGCTGTGGGCCTG
AGAGTGATGATGCAGGTGGTGGCTTTCTTTGACAATCTTG
TTTGAGTAACAAGCTGTCTGTGCTGTGAGCTTTGAAAATG
CTCATTGTCCACAACTGCTTGAAGAAAGCACTAACAGGCC
TCTTCAGCTCACTTTTTTTTTGGTTTATGTGAATGCTATG
TGGTGCTTTTTCTCTGTTAAGATGTTTGGCTTGGTTTCAT
AACAGTCCCAAAGAAGTAAAAGGTTGCATTTACGGGAAAC
GTTGCCATTTTTGGCAGCAGTGGGATTGATTGGCACGCAA
CGAGTGACTATGTGAGGTTGGAATGAATATCCAGTCTCAG
CCACCCAAGGGAATGGGGGTTTCGATTTAAGCCTTGGAAA
AGGTGGTGGCAGAGGTGCCTGGCTGGCCAGGACTGGCTAC
ATGGCCGTGATGGTGTTCCTCATGCCAGCGGTCAACACAT
CGCCGACGTGCATTCATGAAGAAGTTGCTGACGGTGCTGA
GTTCCAGGCCGAGCTGCTGTGAGATAGTCAGCTGCATTTC
CTTCGAGGGCCGCTTGTTCTCCTTGAAAATGGCGATGAGT
GTGCGACGCTGGAGGTCGGTGAAGACCAAACGCTGTTTCT
TGGGCGCCATATTGCGTTCCTTGTGCTGCTCCTGTTCCTT
TCGCTTGCAGGCTGTGGGGATCAGGAGGATGAATAAGAAA
AGATCAAGGAAAGTGAAGTGGACAAAGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp8b3-202 Contained in:
[BAC] CH211-195M2 (1)

Genome Resources: Vega_Trans:OTTDART00000011762 (1),  Ensembl_Trans:ENSDART00000137371 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW076635 (1) 526 nt
GenBank:AW077974 (1) 361 nt
CITATIONS (2)