ZFIN ID: ZDB-TSCRIPT-090929-2050
Transcript Name: aox6-202
Previous Name: aox6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011695 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011695|OTTDARG00000010180|ZDB-GENE-050208-742 aox6|OTTDARP00000010090 CH211-246M6.10-001 LG_ BX649296.3 Danio rerio protein_coding NOVEL, 3944 bp
ATGGCTGAACAAACCAGGAACGATGGCTTGATATTCTATG
TCAACGGCAAAAAGATAGTGGAGAAGAACCCAGATCCTGA
GACTATGCTTCTGCCCTATTTGAGGAAAAAATTGCGTTTG
ACTGGCACTAAATACAGCTGTGGTGGAGGAGGATGTGGAG
CTTGTACCATCATGGTGTCCAGATATGACCCTCAGACTAA
GAGCATCAGGTATTACATGAACGGGTGTCTGTTTCCCATC
TGCCATCTTCACGGAGCCGCAGTGACAACTGTTGAAGGCA
TCGGAAACACCAAAACCAAATTACACCCGGTCCAGGAGCG
CATAGCAAAGGCTCATGGGTCTCAATGTGGCTTCTGTACT
CCTGGGATGGTGATGTCCATGTATACATTGCTAAGAAACA
ACCCACATCCCACCTTGGATGACATAACAGAGTGTCTTGC
AGGTAATTTATGCAGATGTACAGGATACCGGCCCATCATT
GATGGCTACAGGACCTTCTGTGAGAGTGAAAACTGTTGCC
TGTTAAATGGCAGCACGTGTAATGTGCTCAATGGAAATGG
ATCTGCGGAGAATGGTCATGCAGAGCTGTTCAGTAAAGAT
GACCTGCTTCCCCTCGACCCGTCCCAGGACCTGATCTTTC
CTCCTGAGCTCATGAGAATGGCGGAGGACAAGGATCAGAG
CATTCAGAGGTTCTGTGGGGAGAGAATGACCTGGATCAGT
CCTGGATCTCTAGATGAGCTGCTCCAGCTGAAGGCTGATT
ACCCACAAGCCCCTTTGGTCATGGGGAACACCACTATAGG
TTTGGACATGAAATTCAAGGGTATCTTCCATCCCATAATA
ATATCTCCAACACGAGTCCCAGAATTGTTCAAGGTTAACC
ACAGATCAGAGGGTGTGTGTGTCGGAGCTGGATGTAGTAT
GTCAGATCTGAAGAGCGTGTTGGAGAAAACTATAAATGAT
TTTCCACCAGAGAACACACACACGTTTCGGGCTCTTCTGC
AGCAGATAAACCTCGTTGGAGGACAACAGATCCGCAACGT
GGCTACACTGGGTGGCAATATTGCAAGTGCATATCCAAAC
TCAGACCTGACCCCTGTGTTAGCTGCTGGCAGATGCACTC
TTGTAGCTCTTTCTAAAGATGGACGAAGAAGGCTGCCTAT
TGATAAAGACTTTTTCCTTGGATTTGCAAAGACGATTCTA
AAGCCAGAAGAAATACTGTTGTCTGTTTTCATTCCAGCTA
CAAGACAAAACGAGATTGTCCATGCCTTCCGACACGTCCC
GCGCAAGGAAAACGCATTAGCCACACTGAATGCTGGGATG
CGGGTTTGGCTCAATGACAACTCAAATGTGGTGAAGGAGA
TCAGTATTTACTATGGAGGAGTTGGAGCCACAATTCTCAG
CGCAGACCATGCATGCCAGAAGATTGTAGGAAGGCCTTGG
GAAGAGGCGACATTAAACGATGCGTACAGCGCACTGTTTG
ATGACGTCAAACTTGACCCTGCGGCTCCAGGCGGGAAAGT
GGATTTCAGAAGATCCCTGACTTTGAGCTTGCTTTTTAAA
TTCCATCTACTCATCCTCCAGTATCTGAAGGAAAAAGATG
TGATTCAGATGGAAGTACCACAAGAGATGCAAAGTGCGAT
TCAACCTCTTCCAAAACGCATTCTACCTGGTTATCAAGAA
TTTCAGAATGTCTTGGAGGACCAGTCGGCTCAAGATCTGG
TGGGCCGTCCAATGATGCACCGGTCAGCTCTGAGTCAGGC
TACTGGAGAGGCAGTCTACTGTGATGATCTGCCATACACC
GATGGTGAACTTGTCCTTGCCATTGTGACCAGCTCCAAAG
CACATGCCAAAATCACTCATATTGACTTCAGTGAAGCTCT
GAAGCTGCCTGGTGTTGTGGACGTAATCACTGCTAAAGAC
ATACCGGGCAAAAAGTTCAGAACCTTCACCGGCTATGATG
AGGAACTGCTGGCTGAAGATGAGGTGTCCTGTGTTGGTCA
GATGATCTGCGCTGTGGTTGCAGATTCAAAAGCGCATGCT
AAACGTGGAGCGGCAGCGGTAAAAGTTAGCTATGAAGATC
TACAGGATTGCATCTTCACTTTGGAGGAGGCCATCGAAAA
AGAGTCTTTCTTCCTGCCTAGAAGACAGATCGAGCGAGGA
GATGTGGAAAAGGGATTGAGAGATGCCGAGCAAGTGTATG
AAGGGGAGATTCGGATTGGAGGACAGGAGCATTTCTACAT
GGAAACTCAGAGTTTTCTGGTCGTTCCAGTTGGGGAAGAG
AAGGAGATGAAGGTTTATTTGTCAACTCAGCATCCTACAT
ATACGCAGGAGGCAGTTGCAGAAACGTTGGGAATTCCATC
CAATCGTGTTACTTGTCACGTTAAGCGATTGGGCGGAGCC
TTCGGGGGAAAGGTCACCAAAACTGCCATTTTGGCCTCCA
TCACTGCAGCTGCGGCATGGAAAACTGGACTTCCAGTGCG
ATGTGTTTTGGAAAGAGGAGAAGACATGCTGATAACCGGA
GGACGTCACCCAGTGGGATTCATGAAGAATGGAAGGATAA
CAGCAGCTGATTTCCAGTACTACGCCAATTCTGGAAACAA
AGTGGATGAGTCCGTACTGGTCGCAGAGAAGATCCTCCTG
CACCTCGATAATGCTTACAACATTCCCAACCTGCGCGGAC
GATCTGCAGCCTGCAGGACCAACCTGCCCTCCAACACTGC
ATTTAGAGGGTTCGGTGTGCCCCAGTGTATGCTGGTCATC
GAGAGTATGATTGATGATGTGGCTCTTCAACTCGGACGTC
TACCTGAAGAGATCAGGGAGATGAACATGTACAAGCAAGT
TTCCCTCACTCACTACAAGATGGAGTTTGACCCAGAAAAC
CTTGTCCGCTGCTGGAAGGAGTGTATGGAGAAATCTGACT
TCAGTCATCGCCGTAAAGCCATCGATCTCTTCAACCAGCA
GAACCAGTTCAAGAAGAGAGGAATCTCCATCATACCCATC
AAATACGGCATTGGCTTTGCTGAGGGCTTCCTCAACCAGG
CTGCAGCTCTCGTGCACATTTATAAGGATGGATCTGTGCT
GGTGAGCCACGGCGGGGCAGAAATGGGTCAAGGCCTACAC
ACTAAAATCCAACAGGTGGCCAGTCGAGAGCTGAATATTC
CTGCATCTTTGATCCACATTTCTGAAACCAGCACACAGTG
TGTCCCGAATACCTGCCCGTCTGCTGCATCCTTTGGTACC
GATGCCAACGGGATGGCAGTGCAGGATGCCTGCCAAATAT
TATACAACAGACTGGAGCCAGTCAGAAAAAAGGATCCTAA
GGGGACATGGCAGAACTGGATTATGAAAGCGTTTTTGGAG
AAAATCAGTCTGTCGGCAACAGGATATTACAGAGGTCATG
ATCTGGACATGGACTGGGAGAAGCAGGAGGGAAGACCTTA
TGCTTACTTTACATATGCAGTTTGCTGCAGTGAGGTGGAG
CTAGACTGTCTGACTGGAGAGTACAGGACCTTGAGGACGG
ATATTGTTGTTGACATTGGCAGAAGTATAAATCCGTCCAT
CGATATTGGTCAGATTGAGGGAGCGTTCACGCAGGGATTG
GGTCTCTACACCATGGAGGAGCTGAAATATTCTCCGTCTG
GTGTTTTGTACACACGTGGCCCAGGCCAGTACAAGATCCC
AGCCGTATGTGACGTCCCGCTCAACTTTAACGTCTATCTT
TTAGCCGGCTCATCCAACCCTCACGCCATCTATTCCTCAA
AGGGGATTGGTGAGCCAACGTTGTTCTTGGGCAGTTCTGT
GTTCTTCGCTATTAAAGACGCTGTGACTGCAGCCCGAAAA
GATGCAGGTTTAACCGGTCCGTTCCAGCTGAACAGCCCTG
CCACCCCAGAGCGGGCATGTCTAGCCTGCGCCACACGCTT
CACAAACATGGTACAACAATAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aox6-202 Contained in:
[BAC] CH211-246M6 (1)

Genome Resources: Vega_Trans:OTTDART00000011695 (1),  Ensembl_Trans:ENSDART00000142548 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE693582 (1) 859 nt
GenBank:EB931115 (1) 657 nt
GenBank:EE204654 (1) 537 nt
GenBank:EB961608 (1) 187 nt
CITATIONS (2)