Transcript

ppp3r1a-201

ID
ZDB-TSCRIPT-090929-20406
Name
ppp3r1a-201
Previous Names
  • ppp3r1a-001
  • si:ch211-274c22.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040233 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040233|OTTDARG00000029341|ZDB-GENE-081113-3 ppp3r1a|OTTDARP00000032160 CH211-274C22.8-001 LG_ BX323887.10 Danio rerio protein_coding NOVEL, 1203 bp
ACGGAAACGGACGGAAAACAGGTTACCGACAAAAAAACAG
CGCTTTTCTGCACAAAACCACAAGACCGAGAGCAGGATTC
TCCTTCTACATCTGTGCTGTCATTTATTGCTGTTCATTTC
CGAGGGGGAATTCCGTCGCACAGGCAGCAAAATGGGAAAT
GAGGCAAGTTATCCCCTGGAAATGTGCTCGCATTTCGATG
CTGATGAGATTAAACGGCTGGGAAAGAGGTTTAAGAAACT
CGACCTGGATAATTCAGGATCTCTGAGCGTGGAGGAGTTC
ATGTCCTTGCCCGAGTTGCAGCAGAATCCGCTGGTGCAGA
GAGTCATCGACATATTCGACACCGACGGGAACGGAGAGGT
GGATTTCAAAGAGTTCATCGAAGGCGTCTCTCAGTTCAGT
GTGAAGGGAGATAAAGAGATGAAACTGCGCTTCGCCTTTA
GGATCTACGACATGGACAAAGACGGCTATATTTCCAACGG
CGAGCTGTTCCAGGTGCTGAAGATGATGGTGGGCAACAAC
CTGAAGGACACGCAACTGCAGCAGATCGTGGATAAAACCA
TCATCAACGCAGACAAAGACGGAGACGGGAGAATATCCTT
CGAGGAGTTCTGCGCCGTTGTTGGAGGTCTGGATATACAC
AAGAAGATGGTTGTGGACGTGTGATGGAGCTGCTCTCCAT
CTGATCCGCTTTCCTCTCTGGATATCCAGCAAATGCTCTC
TGTGTGTTTCAATGGAAGTATTTAAGCCACTTTTGTCAAC
TAGAAGCCAGTGTGTGTGTGCGCGAGTGTGTGTGCGTGAG
TATGTGTGTGTGTGTGTGTTATTGAGCTGCTCAATAACCT
GCTGGCGGACACTGAACGAGCATCTCAGCTGAGGAGGAAA
CCATATTTATTTAGTTTTATTTTTTAATGCTTTTGTTTGT
TTGTTTTTTTACAATTAATTTAATCTTTTGAAGAAGAAGA
AGAAGAAAAAATATTAAGTATGATATCTATAAGTATATAT
ATATATAAGGTATGACGTGTGCCAAGCAGAACATACAGAA
CAAACACACAAACAAAAAGCTTCTCTTCAACTGCATGACG
AAACCGAGCGTCTGTCTGTTTGACTTTGTGATATACACTA
TTTCTATTATTCTAGCATCTAACCATGTTTAATACCTGTT
CTTTTGTATTAATGGTGATCATGTATAAATGTTTATATTG
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations