ZFIN ID: ZDB-TSCRIPT-090929-204
Transcript Name: esyt1b-201
Previous Names: esyt1b-001, fam62a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002365 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002365|OTTDARG00000002194|ZDB-GENE-040724-209 esyt1b|OTTDARP00000002092 CH211-239J9.4-001 LG_ AL929108.5 Danio rerio protein_coding NOVEL, 5100 bp
ATGTCGCATGTAGATTCAGAGACGACAAATGACTCGCAGA
AGATTACCGAACCAGCGCAGGACAGTTCGTCTGGAGAAAT
GGACGTCCCGAAGACCAAATTGTTCGACGCCAAGGCGATC
TTGTGGACTTTTGGGAAATGTCTCACCGCCTTGTTGCCCG
TGTACCTGGCCGGGTACTATCGGATGAGCACCAGTTTGGT
GGTGTTTGGGATGATGGTTTACGCAGGATGGAAACACACG
CGTGAGGCGAAGGAGGCGAGACTGAGGTCTGCCATACAGC
TAGTAAACGACGAGCAAGAATATGTGTCCTCCAAATCATT
TAGAAGTAAAAGAGACCTGCCTTCTTGGGTCAACTTCCCA
GATGTGGAGAAGGTTGAATGGCTAAACAAGGTTATCCACC
AGGCCTGGCCATTTATTGGTCAGTATTTGGAGAAGCTGCT
GACGGAGACCATTGCTCCGGCCATCCGTGGCTCCAGTGCT
CATCTGCAGACCCTCAGCTTCACCAAGATAGACTTCGGTG
GTAAGCCAATGAAAGTGGTCGGCGTGAAGGCTCATACAGA
AAACGATAAAGGTCAAATTCTGCTTGACGTTTACATCAGT
TATGTTGGGGATGTGGAGATAAACGTGGAGGTGAAGAGAT
ACTTCTGCAAAGCTGGTGTGAAGGGAATACAGCTTCATGG
AATGATGCGTGTGATTTTGGAGCCGCTGATCAGCGACGTC
CCAATAGTAGGAGCTGTGACCATGTTCTTCATCCAGAGAC
CTAAACTGACCATTAACTGGACCGGTCTGACCAACCTGCT
GGACATTCCAGGACTCAATGTGATGTCTGACACCATGATC
ATGGATGCGATTGCTTCATTCCTGGTGTTGCCCAATCGCC
TGACAGTTCCTCTGGTGGCAGACCTGCCTGTGGCACAGCT
GCGGTGCCCTTTGCCCAGGGGAGTTGTGCGTATTCACCTG
CTGGAGGCTGATAATCTAGCTGCGAAGGATAATTATGTAA
AGGGTGTGATGGCCGGCATGTCTGACCCGTACGCCATTGT
CCGAGTCGGACCACAAACCTTCAAATCCCATCACCTGGAC
AACACGCTCAGTCCCAAATGGGGTGAAGTGTATGAGGTTG
TCGTTCATGAGGTGCCTGGTCAGGAGCTAGAGGTGGAAGT
GTTTGATAAAGATCCCGATCATGATGATTTCCTGGGCAGG
ACTAAATTAGACTTGGGGATTGTGAAGAAATCTAAAATAG
TTGATGAGTGGTTCAACCTGAAGGACACTCAAACAGGACG
AGTTCACCTCAAACTGGAGTGGCTGACGCTTGAAACTCAC
ACAGAAAGACTGAAAGAGGTTTTGAAGCGAAATGAAAGTG
TGGTGAGTAAAGCTGCAGAGCCGCCCTCAGCCGCCATCTT
GGCAGTGTATTTGGACAAGGCTGAGGCACTTCCTATGAAG
AAAGGCAATAAGGATCCCAATCCGATAGTTCAAATCTCAG
TGCAAAATGCTACTCGTGACAGCCGGATTTGCTGGAATAC
TGTAAATCCCCAGTGGGAGGACGCTTTTACTTTCTTCATC
AGAGATCCAAACAATCAGGACATTAGTGTACAGGTGAAGG
ATAATGACCGTGTTCAGCTTTTGGGGAAAATGTCTATTCC
TGCATCCCGTCTCCTCTCTCATCCCGATCTGTCTATGGAT
GAATGGTATAATCTGGAGAATTCTGGCCCAAAGAGTCGCA
TTCACATCAACACAGTGCTCAGGGGGCTGCTGCGGATCCA
CTTGGTCGAGGGTCAGAATCTGGTGGCTAAAGACAATCTG
ATGGGTGGGATGGTGAAGGGGAAAAGCGACCCATATGTCA
AGATCCAAATCGGAGGTGAAACCTTCAAAAGTCACGTGAT
CAAGGAGAACCTCAACCCCACCTGGAATGAGATGTATGAG
CTTCCGGGTCAAGAGCTCACGTTAGAAGTTTTTGATAAGG
ACATGGATATGAAAGATGACTTTATGGGCAGGCTGAAGAT
GAGTCTGAGTGACATCATCAGCTCTCAGTACATTAATGAG
TCAAAGAGCTCATTTCTGAATAAGGCAGTGCCGTCTGCAG
CTCTCCTGTTTGTGTATGTGGAGCAAGCATATGAGCTTCC
TGTGTGTGATCGCACCAGCACTCCTAAATGGGATGAAGCG
TTTTACTTTCTGGTTCGAGACCCTTTGAATGAAGACCTTA
TTGTGAAGTTGTCCCATAACTGGGATTTTTCCGTGGGGTC
TGTGGTGATTCCTATCAAAGAGCTTCTCTCTGAGCCGGAT
CTGCTGCTGGACCAGTGGCTGGATCTGGACGGAGCTTCAC
CTCAGAGTCAGATTCTGCTCAGAGCTCAGCTGAAAGTCAC
ACAAGTCTCCAGTTCAGATGACCTTCGACCCCTGCACACC
AGCCCTGACCCCAGCTTTGGTACAGAGGGTGTTCTGCGGC
TCATCCTGCTGGAGGCTCAAGATCTGGTGGCGAAGGATGG
TCTGATGGGTGGGATGGTGAAGGGGAAAAGTGACCCGTAT
GTTAAGATCCACATCGGTGACACAACATTTAAGAGTCACG
TAATCAAGGAGAACCTCAACCCCACCTGGAATGAGATGTA
TGAGCTGGTTCTGACCTCCAGCTCCTCTTCTGAAGTGCTC
GTAGAGGTTTTCGACAAGGATATGGACAAAGATGACTTTT
TAGGGAGGATGAAGATCAGTCTACAGGAGATCATTCAGTC
TCAGATCACTGACAGATGGTTTTCTCTGAGTGACGTCAAA
CATGGTCGTGTTCATTTGATTCTGGAGTGGCTGAACACAG
TGACAAAACCTGACCCACTGCAAAAGGCTGTGCAGTTACA
GTCAGATCATTCATACCTGAACAAAAGTGTGCCATCGGCT
GCTCTGTTCTTCATCCTCCTGGAAAGAGCTCATAATCTGC
CTCTGAAGAAGAGTGGAAAAGAGCCTAAAGCTGCTGCAGA
GCTGGTGTTAGGAGACATCACTCACAAAACTAAGGTGTGT
GAGAGATCCATGTCTCCTCAGTGGAGCGAAGCTTTTCACT
TCCTGGTTCACAAACCTACTGAGGAGATTCTTATTATCAA
GCTTTCCAGTGCATTCGAGCAGCCGCTGGGCTCTCTGGTT
CTGCCAATCAGAGAGCTGCTTTCTAAAACAGACCTGCTGA
TGGACCAATGGCTGAGTCTGGATGGAGCAGCTGCTGACAG
TCAGATTCTTCTCAGAGCTCAACTCAAGATTTTGGACTCA
AGGCTGGATTTGAGTGTTTTTCATCGTCAGAAGCCCGTTG
TTGAAGATCATTCAACAGGAGAAGAGCATGAAGAAAAAGG
CCCAGCTACTGCTGAACATTCACCCGCTGCAGTCAGTAAA
GAGTCGGAGAAGAAAACACTGCCAGCAAAGCAAAGCAGGT
TGAGTGAACTTGCAGCATCTACTTTTCCAGTCCCTTTATC
ACTGCCTGAAGAACATCAGAAACAAACAACTCACGCCATT
GAGGAGCAACACACACCTTCGACACCTAAAACACACATGC
CGACTGAGGATCTCAGTAAAGCGCCTGACTCCACTACTAA
TATTGCTGAACATAAGGAATCAGCCCATAAAGATCCACAA
CACCTGGATAAAGCAACAGAACCGTCTCACAAGAGTAGTT
CTCCCAGTGTTCCTGCTGAGGAGACTAAAGTTACCAGTTC
TACAGACACTCGACCCCAAAAGACGAGCCACAACTCCAAC
TTTGGCACCAAGGGGCTGCTGCGGCTCCACCTGCTGGAGG
CTCAGGATCTGGTGGCGAAGGATGGTCTGATGGGTGGGAT
GATGAAGGGGAAAAGTGACCCCTATGTCAAGATCCACATC
GGAGACACAACATTTAAGAGTCACGTGATCAAGGAAAACC
TCAACCCCACCTGGAATGAGATGTATGAGCTGATTCTGAG
TCCTGATCCTAATCTAGAGGTGAAGTTCGAGGTCTATGAT
AAAGATGTTGATTCTGATGATTTTCTTGGAAGATTTAAGC
TCAGACTTGGAGACATCATCAAATCTCAGTACAATGATGA
GGTTATGCAGATGCAGAGCTCGCAGTCCTACCAGAACAAG
AGTGTGGCTTCAGCAGCGCTGCTCTTCATTCTGTTAGACA
GAGCTCATCAGCTGCCCGTGTGTGAACGTTCATCTTCTCC
TCACTGGAATGAAACTTTTGACTTTCTGGTTCACGACCCC
AAAAAGGACGTGCTGGTGATCAAGAGAGCTGCTTTTAAAA
CCAGATCTTCTGCTGGACCAATGGCTGAGCCTGGATGGAG
CTTCAGCACAGAGTCAGATTCTGCTCAGAGCTCAGCTGAA
GGACAAATCCAGCTCTCCATGTCCTTCCAGAAGAAGCTGA
CGCTGCTCGTCCACAACTGCAGGGGTCTGGTCACATCATC
TAAGGACAGCTTAGACACTTACGTCTCCATCATTCTGCTG
CCAGATAAAAGCAAGGCCACCAAGAGAAAGACCAGTGTGA
AGAAGAAAACCCTCAATCCAGAGTTCAATGAAAAGTTTGA
GTTTGATATGAGTATGGAAGAGGTTCAGAGACGAGAGCTC
AGTGTGTGTGTGAAAAACGCTTCCTCGTCCTTCATGAACC
GAGACAAAGACGTGATCGGCCAGGTGCAAATAGACCTGGG
ACACATTGATTTAATCTCTGGAGTCACACAATGGTGAGTT
TTTATTCATTTGTACACAAACATGCTTTTATTTTATTCTA
ATATGAGACCCTGGACCACAAAACCAGTCTTATGTTCCAT
GAAGACATTAAGTGTGCTACTAAAAACATATCAACACTCA
GTTTTTGACCAGTAATGTGCATTGATCAGAACAGAATGTG
ATTATCTAATTTACATTTTTTTGGAACCTCAAATTCCAGA
CTTTGGAATGATAACAAGCTTTTATTATTGCAGCTTTTTA
AAAAATTTTCTTCGGTTAAGTCTCATCAGGGGTCGCCACA
GCGGAATGAACCACTAACTATTCCAGCATATGTTTTAGGC
AATGGATGCCCTTTCAGCTGCAACCCAGTACTGGGAAACA
CCCACACTTTCACATTCACCAACACACTCATACACTACGG
CCACTTTAGTTTATTCAATT

esyt1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA esyt1b-201 5100
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
esyt1b-201 Contained in:
[BAC] CH211-239J9 (1)

Genome Resources: Vega_Trans:OTTDART00000002365 (1),  Ensembl_Trans:ENSDART00000144174 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL922025 (1) 539 nt
GenBank:BQ615300 (1) 437 nt
GenBank:EB912605 (1) 361 nt
CITATIONS (2)