Transcript

st3gal1l-201

ID
ZDB-TSCRIPT-090929-20364
Name
st3gal1l-201
Previous Names
  • st3gal1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040188 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040188|OTTDARG00000029313|ZDB-GENE-060321-2 st3gal1l|OTTDARP00000032123 st3gal1l-001 LG_none CU652215.3,CU658288.8 Danio rerio protein_coding KNOWN, 3484 bp
TATAACCCACTCCAGGAAGATCCATGTATTTTTGCATTTT
CATCTACCCTTACTAAAATAACAAAACTATCAGACAAGCA
GGTGCACTAACCATCGTCATCAGGAGTCACACACAAACCC
CGCCTTCCTGCTGAAGTCTAAAAACACAGCACAGGTCACA
TTACTCTTACACACACCATCAGGGAAAACTAGAGAAGATT
GGGTTTCACAGAACAAGTTTGAGAAGTAAACCTAACAAGA
CCTCTCCAAAGCAGGTCAAATACATTTCTGATTTCAATGG
CAAAACTGAGGACCACTGTACAGCTGAAACGTCATTTCCG
CTACATCACAGCATTTCTGAGCTCTACTACTATCTTGTTA
TTTTTGTATTTTCAAAACTCAGCAGTAATTACCACCTATG
CTTCTTATGGGATCGCCTCAAAACGTGCTGCATGTGGATG
CAATACATGTGTGGCGAGCCGAGAAAATGGTACTTGGTTC
AGTGAGCGGTACAACCGCACCATACCATTTCTGCTCAACA
GCACCAACAGTGAATTAAATGAAGACATCTTAAAGTGGTG
GAAGGGGCTTCAAGGTGCAGCAGATGTCATCAACTACACA
TATGTGGTGGACATTTTGTTTTCTCTGTTCCCCGATGAAG
ATCACTTCTCAGATGCTGGTCCAGATCGCTGCAGGACCTG
TGCTGTGGTGGGAAACTCTGGGAACCTTCTGCGCTCCAAT
TATGGGCGTCTCATAGATCTTCATGACTTTGTTTTGAGGA
TAAATAAAGGCCCGACAAAAGGTTTTGAGAAGGATGTGGG
GTCTAAGACCACTCACCGGATCATGTATCCCGAGAGTGCT
GTGGATTTGGACAACTCCACTCATCTGGTGCTCTTTCCTT
ATAAGATTCTGGACATGCAATGGCTCATTAGTATCTTCAC
AACTAAACACATCACAGAAACATACATGTCAGTACCATCA
ACAATCAACGCAGACAGGGACAAGGTGATGATTCTCCATC
CTGAATTCATCAAATATGTGAATGATAAATGGGCTGAGGG
TCATGGTGGATATCCCTCCACTGGCTTCTTAACGCTGATA
TTTGCTCTTCACATCTGCGACGAGGTGAATGTTTTTGGGT
TCGGAGCTACCAGTGAAGGACAGTGGCATCATTATTTTGA
CGATTCGATGACTTCCTTTAGCAATCTTCACGGTGGAGAC
TTTGAAAATCAAACGATTCATTTCCTCCATCAACAAAACA
AGATTTCATTGCACAAGGGTTGGACATGAAGCAGGTTTCA
GGAGAAACATGAGTACCCCGTGACATCAGTATTGGATAAT
GAGCTGAGGAATCTGAACTTGCAGGTCTACGGGAGACGTG
ACGAGAGATCAACTTTCCTGAGGAGATTCATTTGAGCTCA
ATGAAAATGTGGCTTTAGGTTATTTATTTATTTATTTTGA
TGAACTTTCCAGGATCTTCAAGCACCACTGAGGCTCGCTG
TTTACAATGGAATCCACACATTAAAGGCATCTTTCTGTAT
GTTAGCTTCGGGAAATGAAGTTGAATTAAATAAATATAGG
AGCTGGAGCGACCTGGGCTACAAAACACTTCAGCACATGC
CACTAACACATATAACATCATGGCATGTGATTGCTGAAGT
AATTGATGCAGAAATATACAGCGCAGACCAAGTATTAGGT
GCTTTACATGTTCACACTGTTCAGTAGTCCAACATTTCTG
TGTTACAAATCCTGCTGCTGTTTGCTATAACTGATATTGT
GATTTAATCTGAGATGCTGTCATACTGTAATATTTTAATT
TAATCTAAGATGCTGTTATTTATACGGTAATATTGTGATT
TAATCTGAGATGCTGTCATACTGTAATATTTTAATTTAAT
CTAAGATGCTGTTATTTATACGGTAATATTGTGATTTAAT
CTGAGATGCTGTCATACTGTAATATTTTAATTTAATCTGA
GATGCTGTTATTTATACGGTAATATTGTGATTTAATCTGA
GATGCTGTCATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATACTGTAATATTTTAATTTAATCTGA
GATACTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATATGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATATGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTTTAATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTACACGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATATGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACGGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATATGGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTAATTTACACGGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATATGATAATATTGTGATTTAATGTGA
GATACTGTAATTTATTCGGTAATATTGTGATTTAATCTGA
GATACTGTAATTTATACTGTAATATTTTAATTTAATCTGA
GATGCTGTAATTTATACTGTAATATTGTGATTTAATCTGA
GATGCTGTCATTTATACTGTAATATTTTCATTTAATCAGA
GTTTTAGCGTTTCATTTGCTGTAAGCCATCAAATTAAAAA
GAAATAAACATTTAAAATACAATAATATGCGTGTAATAAA
TCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations