Transcript

snrpd1-202

ID
ZDB-TSCRIPT-090929-20351
Name
snrpd1-202
Previous Names
  • snrpd1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040175 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040175|OTTDARG00000029303|ZDB-GENE-020419-14 snrpd1|OTTDARP00000032114 snrpd1-002 LG_ CU424444.7 Danio rerio protein_coding KNOWN, 768 bp
TGTAGCTGCTAGTTAGCCGTTAGCTTCATCAGGCGGGAAT
GAATGAATGGGCGAGCGTTTGTTTGAACGTTTTACTCATT
TGTTTTAAGCACATACGTGTTTTAAACTATGTAATAAGCG
GGTTTAGTCTTAGATTATTAATACATTGTGCGTTTTTTGG
TGGTAGTTTGATCATGCGGGGTCTTAAATGCAACAAATAC
ATAAACAGAAACAATAACTGTTAATGCTAAGTTAGCTACA
TTTATTTACTAGTTTCTAAATATGCTAGCTGTATATAATC
ATATAATTATGTTAATAGACACTATAGTGTGTAGTTAGGA
AGTCTAAAGATTATTGGATATATAGTTTATCATTTGTTTT
AAATATAGTTATCAGTTTATTATCATTAGTAAGCTGTAAA
TACTTTATATAATCATATTGACAAAATGCTTTATATGTAG
ATATTAGACGTTATGTTATTATAATTGTTTATCATTGTTT
TTATGATTGTGACCTGCAGGTTTTTGATGAAATTGAGCCA
TGAAACCGTCACGATTGAGCTGAAGAATGGCACACAGGTC
CATGGCACAATTACAGGTGTGGACGTCAGCATGAACACAC
ACCTCAAAGCTGTGAAGATGACCCTGAAAAACAGAGAGCC
CACTCAGCTGGAGTCACTCAGCATCCGAGGAAACAACATC
CGCTACTTTATCCTGCCGGACAGTCTTCCTCTGGACACGC
TGCTGGTGGACATCGAGCCCAAAGTCAAGTCCAAGAAGAG
AGAAGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations