Transcript

kcnip2-202

ID
ZDB-TSCRIPT-090929-20259
Name
kcnip2-202
Previous Names
  • kcnip2-001
  • si:ch73-173h19.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040076 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040076|OTTDARG00000029239|ZDB-GENE-081031-91 kcnip2|OTTDARP00000032035 CH73-173H19.2-001 LG_ CU570883.8 Danio rerio protein_coding NOVEL, 1086 bp
CGATTATATAGATATATAGGCTGTATAGGATCCATATATA
TAGGCTCTTATAATAACAATCAGTGAGGTTTGATAGTACA
CTCCGAACAGTGTACACACGCTCCGCATCAATGAACCGGA
CACCGGAGCGAGCTCAAACCTGCACGCAGATCGACGGGAA
CTTTCTAATGGAAGTGTAACAACATTATTCGCACTCCAAA
GCCTCACACTTAACACTTGCTGGCTTTATAGACGGATAAC
TCAATTTTATTTAACACTAAAGGGATTAAATGTAGGCTGT
TTTATCTGACTGGGGCTTTTTTGTTTTGCGCGAAGACAAA
ATGAAGGTGAAATCCAGAGATGAGAGTTTCAATACTTCTG
GAGAATGTGACGGATCCAATGACCTGCTCACTGGTAATCC
TCCCTCCGGCCAGAGGAAGAAGAACATGAAACAGCGCTTT
CTCAAACTCCTGCCCTGCTGTCATGTGGACTCCACTCCTG
CGGTCAGACAAAGCAAACAGTATAGAGGAGGATTTTGAGC
TTGCTACTGTGTGCTACAGGCCGGACAGTCTGGATAAACT
GATGGAGCTGACCAAGTTCACCAAAACCGAGCTACAAATC
CTGTACAGAAGTTTCAAAAATGATTGTCCCACTGGAGTAG
TCAATGAAGAAACCTTTCAACTAATCTACTCTCACTTTTT
CCCTCATGGAGATTCTAGTGCATATGCACATTTCCTGTTC
GAGGCTTTCGACAGACGCAAAAATGGAGCAGTGAATTTTG
AGGACTTTGTGGTGGGCCTGTCGATCATTTTGCGCGGCAC
AGTCACCGACAGACTATCCTGGGCCTTCAGTTTGTACGAT
CTCAATAAAGACGGCTGCATCACTAAAGAGGAGATGAATG
ATATTATGAAATCCATTTATGATATGATGGGGAAGAATAC
GTGTCCGTGCATGAACGACAGCGCGCCCAGAGAACACGTG
GAGAGCTTCTTTCAGAAAATGGATCGCAACAATGACGGCG
TGATCACGATGGAGGAGTTTCTGGAGTCCTGTCAAAAGGA
CGAGGCCATCATGGAGTCCATGCAAATGCTGGATCATGTC
ATCTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations