ZFIN ID: ZDB-TSCRIPT-090929-20203
Transcript Name: ccnyl1-201
Previous Names: ccnyl1-001, zgc:153047-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039970 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039970|OTTDARG00000029176|ZDB-GENE-060929-732 ccnyl1|OTTDARP00000047933 ccnyl1-001 LG_ FQ377896.6 Danio rerio protein_coding KNOWN, 1574 bp
GTGTAAATGCATGGAGTCCCGTTATATGACTGGCACAGAG
CTACATACCTCTTGAGTTTGGAGCAGTGAGACAGTACAGC
AGTAGATGCTGACTGTGTGTGTCTATTTCAGCTCTTCATG
CACCCACTTTTAGCTTGAGTTCATTCATTCATTCATTGGA
TCCATTGGGTGACTTCTGATGACAGAAGCAGCCCAGGTGT
GAGCTTCAAAAGGTGTTTGCCATAGACTAACACACCTGAG
CAGGTCGAGCTTGTGATTGTAGGTGTGAGTCATCATGGGC
AATACAGTGTCCTGCTGCGTGTCCCCCAGTGGGAGCCCCA
AACTACCCCGGCAGGTGGAGCGTCTGGAGGACTACCAGAA
CAACACAGACATCAGCGATGACACTGGTCCATACCTGCAG
CACATCAGTGACCGGGAGGTGCCGGATGATTTGGCTTTAG
AATCCAACCCCTCAGATCATGCCCGCGCCAGCACCATCTT
CCTTAGCAAGTCACAGACAGATGTACGGGATAGGAGGAAA
AGCAATCACATAAACCATGTCTCACCTGGTCTGCTTTCAA
AGAAGTATAGCTCCTGTTCTACGATATTCATCGATGACAG
TACTGTTAGCCAACCCAACCTGAAAAGCACAATCAAATGT
GTCACATTAGCAATATATTATCACATTAAAAACAGGGACT
CTGATAGATCATTAGACATCTTCGATGAAAAAATGCACCC
CTTATCGAGGGAGCAGGTTCCTGACGATTACTCCCGCACA
GACCCTGAACACAAACTCATCTATCGATTCGTCCGGACTC
TGTTTAGTGCAGCGCAGCTCACGGCGGAGTGTGCAATCGT
TACACTGGTATATCTGGAGAGGCTGTTGACGTACGCCGAG
CTGGACATTTGCCCATCTAACTGGAAGAGGATTGTTCTGG
GAGCCATCCTGCTGGCCTCTAAAGTCTGGGACGATCAGGC
CGTGTGGAACGTCGACTACTGTCAGATCCTCAAAGACATC
ACTGTGGAGGACATGAATGAGATGGAAAGACATTTTCTAG
AGCTGCTGCAGTTTAACATTAACGTACCGGCCAGCGTCTA
CGCCAAGTATTACTTTGACCTGCGCTCTTTAGCAGACGAC
AACAACCTGAGCTTTCCTCTGGAGCCGTTGAGCAATGAAC
GAGCTCAGAAATTAGAGGCAATCTCGAGACTGTGTGAGGA
TAAGTACAAAGATCTGAGCAGAGTGGCCATGAGGAGATCA
TTCAGCGCAGACAACCTAGTGGGCATCCGCCGATCCAATG
CCGTTCTTTCATAAAAGCTTTTTCTCGGAACATTCGCCAC
TCCCAAGACGGAGCTCAACGGACAAAACTTGTTCTCTCTC
CCCACCCCTCTGCCTTTGGCTGCAACGATACGCCAGTCGA
GATATCCCACACCTTTCCCAACCGATGCAGAACAACATAG
AGACGACAACAAACTGAAACGGTTACTTTTGTTTGTTTTT
TGCTTACTATGTAGGCTAATAGCTGTGAACTGTCAGTTTT
TAATTGAAATCATTTGCAGATGGAGTATTTTAAATAAACA
CTAATCATGTAACA

ccnyl1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ccnyl1-201 1574
ncRNA ccnyl1-002 (1) 485
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnyl1-201 Contained in:
[Fosmid] CH1073-226M24 (1)

Genome Resources: Vega_Trans:OTTDART00000039970 (1),  Ensembl_Trans:ENSDART00000160387 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124226 (1) 1415 nt
GenBank:EH537896 (1) 984 nt
CITATIONS (2)