Transcript

pidd1-201

ID
ZDB-TSCRIPT-090929-20122
Name
pidd1-201
Previous Names
  • pidd-001
  • pidd1-001
  • si:dkey-201c1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039881 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039881|OTTDARG00000029114|ZDB-GENE-081104-353 pidd1|OTTDARP00000031885 DKEY-201C1.1-001 LG_ CU137647.9 Danio rerio protein_coding NOVEL, 2955 bp
ATGTGATGCCACTCTAGTGATGGAGAGATGAAGACGGAGG
TGCCAGATTCATCTCTCCTTCATTCTCACTATTTGGGGCA
GGGGCTGATGGGAAAAAAGGGGGAATAGATGGAGAGAGAA
GAGAAAAAACAGACTGAGAGGAAAGAGTGGCCGGCCCCAC
CTGATGAGGAAGGAGATGCTGATAGTTTTACAAATAAAAG
AAGGGCGATGCTGATGGAGACGGCTGCTGGACCAGATTTT
TTCGGGAAGCTGGAGACGGAGGATAGTCCACCGTTAGGAG
TCTCTCTTTGCTCTGAGCACACAGACACCTGGGCTCCGTC
CATCGTGTCGTCCTCTTCCTCCTCTCTGCCCTGTCTCTCT
CCTCCTCTTCCTCCGTCGGTGGGTCTGGACGGTGTGCTGG
TGGAGGAGCGGCTGGTGCTGGACGTGTATCGGGGTGGAGC
AGAGGTGCTTCCGGTGTTCTGGGAGTTTGTTCAGGAGCGG
ATGAGAGGCCTGCAGTATCTCAGACTGGGCTCAGAGGACG
AGGGGGCACTAGAGAGAGCATTGAGGGTCCTGCCCCGACT
GACACAACTGCGCTCTCTGGCCATCAGAGGTTGTCGTTTT
CATGATCCTCAGGGCGATCCTCTGCCCGGTCTCCTCTCCT
CTCTGCCAGACTCTGTCTCTTCTCTGTCTCTCCTCGTCCA
CCTCGATCTCTCCTTTAATCGTTTCTCTTCTCTTCCTTCA
TGTCTTCTGTCTTTCTCTCATCTCTCTGAGCTCCTGCTGT
GCCACAACAATCTGACGACTCTACCGGAGGGCATTGGAGC
TCTGGCATCCCTGCGGCGGGTGAGTCTGCTTGGGAACCGT
CTAGTGGATCTGCCCCAGGATCTGGGCCTCCTCTGCGGGC
TGGAGGAGCTGGACGTGTCCTTTAACCTGCTGGAGAAACT
TCCAGATGAACTGGGCCAACTGCAGAACTTACAGCGGCTG
GAGCTGTCAAATAACAGATTAAGATCTCTGCCAGAGACGC
TGGGGTCTCTGCGCTCTCTGAGGCAGCTGCTAATCCAGAG
TAATGATCTGAGGAGTGTTCCTGACTGTTTACACTCACTT
CCGATGCTTGACAAGCTGGATGTGAGGAACAACCCGCTGG
GGCGCCCGCCAACACCACCTCCGCTTGCCCAACTCACCCC
AGTTGTGGAAGATTCTGAAATCCCAGAGCTACATCTTGGA
TTCAATCAACACAGTTTTCAAGTGTCTCCTGCTGGCTGTC
ACGTGTTTCTTCCTGGAGGGGCGGAGCTCTTGTTTCCAAG
GCAATGTGTAGGTGTGGTCACTCAGCTTCAGTGGGCAGAG
AAGAGGCCGGACAGGAAGTGGGTGTGGCTAGAGGAGCATG
ATGTGCTGTTGAGTCGCCAGCTGGAGCTCCGCCCACACGG
AGCCACATTTGAGAAGCTGGTTGGGGTGTGTATTCCCTAT
CGTAAAACACGGAAAGGTGACGTGGTGGTTCGCAGGTTTG
ATGGTCAGTCTTGGACGACACTGACCACCATGACCAGAAG
AGGAAGTGACAAACACAGCTGCAGGCCTGGAGGACGTCCT
GCACGGCTGGCCTGCTGCAGTGTGTCTCAGTTCTCCTGGT
TTGTGGCCGTGTGTTGTCCATTCCTGGACAGTTGCAGTGT
GTCTCCAGAGGGGGCGCTGCTTGTCTCTCAATGCGACCCG
GGGATCAAACTCAGTTTCCCTCCAAACTGTACAGCGGAGA
CGCGCACCGTCACACTGCAGGTTCTGCAGGTGGCTCTGTC
TGAGGTGCAGGATCTGGCTGGAGACCCTCATGCCAGTGCT
GGTCCACTGCTGCGTCTCTCTCAAACTCCCAGCATGCACT
TCCTTCAGCCAATCAGAGTGCAAGTTCCTCTCCCACCTGG
AGTGACAGGACACATGTTGGACCTGTCCCGTCTGCACCTG
ATGCATGGCGACCCCACGGCCCACACCTGGACAGACGTCA
CCGCTCAAGTGTCCCTGTACGTCACACACATCTACGCCGT
CTTCTTCATCACACACTTCTCATGGTACTGGTTGTGGTAC
ACCACTCACAGGTGTGTTAGCGGAGTGGTCAGAAAGATGT
ATCGCCGATTGAAACAGTTTCGGGTTCGATTCCTGGCGCT
ACAGAGGAAAAACGACCCAGAGCAGATTCTGCTGCAGTGC
CTGCCATCTGACAAGGCTGAAAGCCGGCTGGAGTCTCTGG
CGGATCAGTATGAAGGCCCTCAGCCGTCTGAGCTGTGTGT
CCTGCTGGAGGGAGAGCAGTTTTTCGCTGGCTTTGAGAGA
GGCATTGACATCAACTCAGACCGTCCAGACTGTAAAGATG
GCAGACTCTCGTTCACCTTTTACTCTCACCTGAAGAACAT
TAAAGAGGTCTACGTGTGCGCGACCCACCCGGTCCAGACC
ACTGTTAGAGGACAGGTGTCTTTTTACCGGGGTGAAGTGC
CTAGTGATCTTCCAGAGGAAGTGGCCAGAAAAAGAAAAGG
TCACGATGACCAGTGGATGGCGACACTTCCTCTGCGGATT
CCTAACTCAGAGATTGACGGGAGCATCTCAGGTGAGCTGA
ATCTGGGCGACCCAGAAAGCGGATACCTGACCCAGACCAA
CCTGCTGTCCATCTCCTTGCGCATCAACCAGGAGTGGCAA
AACATCGGCATCAACCTGGGCATGAGCTACGAGCAGCTGG
AGCGCATCCGCCACCAGCACAGGGATAACTTCGGGGCGCA
GGTACTGGCGATGCTCTTTCATTGGGCTAGAGGGCAGCAG
GGGGCGGGGCCTGGGGCGGTGCAGCGGCTAATGACAGCGC
TGGTGGACAGTGGTAGGCGGGACTTGGCAGAGGAAGTAGA
GGACATAGTGACTCTGGGGAAGAGGAAGTATGAAGAATCA
CTAAAGAGAGTCGGGCTGGAGACACCGGTTACATCTACAG
AGCCTCAGTCCAGCTGAGACACACACACAACATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations