ZFIN ID: ZDB-TSCRIPT-090929-20114
Transcript Name: si:ch73-299h12.4-201
Previous Name: si:ch73-299h12.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039872 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039872|OTTDARG00000029105|ZDB-GENE-081104-275 si:ch73-299h12.4|OTTDARP00000031876 CH73-299H12.4-001 LG_ CU570788.13 Danio rerio protein_coding NOVEL, 779 bp
CACAACACAAGACGCTACAGATGCGATGTTATGAAAGAAA
GAGGAATTACTGCAGGAGAAGCAACTGGCATGGGAAAGAT
GGGGATTGGTGAAGAACCCTGCAGAATAAAAGAGGAAGAG
ACGGAGGAACAAATAGACCCGATGAAAGCGAATGAAGACA
GAGCACTTCACAGTCAAACAGATCATCATTTCACAAATGA
GGTTGCCAAATATACTCCCACTTTAAAGACTGAAGAGAAT
TTAATCAAAGAATCTACACTAGAAAGTGAAGTCAAAGCAT
CCTTTACTTGCTCCGATTGTGGAAAGACGCTCATGAATAA
ATCATCCTTTAAGAGGCACATGAGGATTCACACCGGAGGA
AAAGGGTTTACATGTGCTCAATGTGGAAAGAGTTTCTCCG
CCAAAAGAGATCTGAGTTATCACACGCGTGTCCACACCGG
AGTGAAAACGTTTACATGTGCTCAATGTGGAAAGAGTTAC
AATCTCAAAAGAAACTTTAGCGATCACATGAGGATTCACG
ATGGACAAAACCCCTTTACCTGCGCTCAATGTGGAAGGAG
CTTTGTTCTGAAAGCATCCCTGAATAGACATCTGAAAAAT
CACTCTGATGAAAAACAATTCGTGTGCGATCAGTGTGGAA
AGAGTTTTGTTTACAGAGGAGGCTATGATGAGCACATGAG
GATTCACACCGGAGAAAGACCATTCGCGTGCACTCAATGT
GGGAGGTGTTTCATTCAGAAAAGAAGCTTCATTCAACATC
TAAATGTTCACACTGGAGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-299h12.4-201 Contained in:
[BAC] CH73-299H12 (1)

Genome Resources: Vega_Trans:OTTDART00000039872 (1),  Ensembl_Trans:ENSDART00000161554 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE327257 (1) 884 nt
GenBank:CO935730 (1) 779 nt
GenBank:AL725054 (1) 676 nt
CITATIONS (2)