ZFIN ID: ZDB-TSCRIPT-090929-20080
Transcript Name: asic1b-202
Previous Names: accn2a-001, asic1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039835 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039835|OTTDARG00000029075|ZDB-GENE-040513-1 asic1b|OTTDARP00000047648 accn2a-001 LG_ CR450748.10 Danio rerio protein_coding KNOWN, 3282 bp
CTGGCATGCATAATAAACTAACACTAATGCTGTTTTCACA
CATTTAGAGACAAATACTCAGTTGGATTTTTTTTTAAATT
CTGAATGCATGCTTGTTTTTAGAATTAAAATGCCATGAAA
TTATGTTCTATAGATGTACCAAAACGCATTTATACACAGT
GATGAATAATGTAAATGTTAATTCTTATGTGGGCGCATTT
GATCTTACATATTGTGTGTTTGTTGCACTCATTCAAATGA
TCTGATATCAGAGCATGATTGCATTCAAATTAAAATAAAC
TGGAAAAAAGAGGATTAACCAATGCGATAGAAAAGTTCAG
TGGACTAAAATGCACCGGAGGATGAGCGCGCTCACAGAGG
AGCAGAGCGCGCGCGCCGGAGATGAAGCTCACGCTTGTTG
CTGAAGCGAACGCTACAAACACTCGTTAGTGAATTACACT
TCGATTGAATTTATGATGATTTTAATTTTTTTTAAAGTGC
AGGACAGATTTATAGTATGACAATGAACCGCGAGAGTACC
CGACGCGAGGAAAATGCCGCGACGCGCCAGTTTCTGGCAA
CAGTTGAGACTTTTATACGGGCTGTATTTCGCTTCCCTGA
GAGGAAAAATATGGAGAACTAACATTTTACAATCCTTATT
TACAACATCGCCGTAATTCAGGCACATGTGATGAATTTGC
ATCTTCCCTCGCTCCAGGAGTACCTCACCATGGTTTTTCA
GTTCAGTCATTTAAGGGGTCTCTTCTGAGGTAAAACTGTG
CGTCAAAACCCTCTCCAAAATGTGCCAAGGCGACGCACCG
CCGAAACCGCGCGCTGAAGGGTCGCTAAAAGAGGCAGGAA
AGCTCTTCTTGAAGCACACGACCTTTCACGGATTGAGACA
CGTCTTTCTGAGCGGCTCGTACCCGCGGAGAGTCGCGTGG
CTCCTGGCGTTTCTGACGGCGTTGGCGCTTCTTTTCACTT
GGTCCTCAAACCGCGTCCGGTACCTGCTTTCATCGCCGGT
GTACACCAAGGCGCATATGGTTTACGCGAAGCGCCTGGTG
TTTCCCGCTGTAACAATCTGCAACAAAAACATTTTACTAC
CGCGGCGAATGAAGAAACCGGACATCTTCAGCGCGGGACG
GTGGCTGGGGATATTCGGGAAAAACTGGCAGGTTTCAGCC
GCGGTTCGCGACGCGCTCGCATCGCTCGATGACGGAACTA
ATGTTGATCCTCCCTGGTCACCGTTTTCTCGCATACTGGA
GTTCAACCACTTTCTGCCTCCTCCCAGAGACTCCCAGCCC
TCAATGAGGCAGTTATTAGACCGTCTGGGTCATCAGCTGG
AGGAGATGCTGCTTTATTGTCGATTTCAGGGGCAGCTTTG
CGGACCGCGCAACTTTAGCACTATCTTCACGCGCTATGGG
AAATGCTACACCTTCAACTCTGGACAGGACGGCCGGCCAC
TTCTGATAACCACGAAGGGAGGAATGGGAAATGGTCTAGA
GATAATGTTGGACATCCAGCAGGATGAATACCTGCCTGTG
TGGGGAGAAACAGACGAGACCACGTTCGAGGCAGGAATCA
AAGTACAGATCCACACGCAGGATGAACCACCTTTCATCGA
TCAGCTGGGATTCGGAGTGGCTCCAGGCTTCCAGACGTTC
GTCTCCTGCCAAGAACAGCGGCTGACGTATCTTCCTCCTC
CATGGGGCGACTGTAAGGCTACGCCGATAGACTCTGATTT
CTTCAACACATACAGTATCACCGCCTGCCGCATCGACTGC
GAGACGCGATATCTGGTGGAAAACTGCAACTGCCGCATGG
TGCACATGCCCGGAGATGCTCCATATTGCACTCCGGAGCA
GTATAAGGAATGTGCGGATCCAGCTCTAGATTTCCTGGTG
GAGAGAGATAATGACTACTGCGTCTGCGAGACACCCTGCA
ACATGACGCGATATGGCAAAGAGTTGTCCTTCGTCAGGAT
CCCCAGCAAAGCCTCCGCCAAATACCTGGCCAAGAAGTAC
AACAAGACTGAGCAGTACATCTCAGACAACATCATGGTGC
TGGACATCTTCTTTGAGGCGCTGAACTACGAGACCATCGA
GCAGAAGAAAGCCTACGAGTTAGCCGGCCTTCTCGGTGAC
ATTGGCGGGCAGATGGGGCTGTTTATCGGAGCCAGTATCT
TAACCATCCTGGAGCTCTTTGACTATCTGTATGAGGTGAT
CAAGTTCAAACTCTGTCGCTGCGCCAAGAAGAAACACCAA
CGAAGCAACAACAACGAGCGAGGAGCCGTTCTCAGTCTGG
ACGACGTGAAGCGCCACGCTCCGTGTGACAACCTTCGCAC
TCCGTCGACCTACCCAGCCAACATGCTACCTCACCATCCG
GGCCAGGGCAACTTCGAGGACTTCACCTGCTGAGCGTAAC
GCAAGTGCGAACATCCAGAGAACAACCAAAGCCGACCCCA
TTCCCAACCGGACATTACCGAACAACCTCTGGATCTGCGA
TTAAACCCAGACGTCAAAGGAACGCTACCAATCAAACCAA
GTACATGTTCACATTCACCCAATGGAAGTGTGCAAAAACT
TTCAACGTTTTCTGAACTTTTAAAGGAAATACTGCCTCAA
AAATGAAACTCCTTGAAGCTTCGTAAATGTGGGAACGAGG
ATTCCCCCATGCCAAATTATAAATAATGGGACTGGGACAT
CGAATAGCTTCTTGCAGCTGGACACCGATGCCTTTTTCTG
TACATAGCGACGGCTCGAAACTGTCTTAAAGACCAGTGGC
TTACGTAGGTCAGTAGATAAATATAGCGCTTACTCACTGT
ATGTAGCCTCATTAGCCCCATCTGCTGGATCAACAGTGTA
TTTGGTGAGAATGTAACTCCCGCCGTGCGGGGGTTTCGGG
ATTCTGGAGGGTTCAGGTCCCATACGACATTGTGTTAACA
AGTCTCATCTTGTAAATGCATGCTGGTCGTCCTGTGCATG
TTTTTTTAGTTTTATTTAGACTTCATTATTATTATTACCG
CCAAGTTTGCCTCAATTATATACAGGTGTTGGAAGATGGT
GTATTCTTTTTTTGTTTGTTTGTTTATACGTGTGATTGTG
TGTGTAAGAGAAAGATTTGATGTCCTTGCTGAGATAAAAA
CTCTACAACGATACGAGAGTTCAGAAAGAAATAAACGACG
TATAAATTCACATCTAAAAAAAAATGCCAAAAATGATTGT
TATTATAATTATTATTTTAAGTTTAGAATTATGCTGTGTT
AACATCAGTCGCGGTATGTGCGGATAAATTGTGGTATTTG
TG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asic1b-202 Contained in:
[BAC] CH211-106J5 (1), CH211-157P5 (1)

Genome Resources: Vega_Trans:OTTDART00000039835 (1),  Ensembl_Trans:ENSDART00000171359 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AJ609615 (1) 2684 nt
GenBank:BC162362 (1) 2174 nt
GenBank:BC162368 (1) 2174 nt
CITATIONS (2)