Transcript

asic1b-202

ID
ZDB-TSCRIPT-090929-20080
Name
asic1b-202
Previous Names
  • accn2a-001
  • asic1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039835 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039835|OTTDARG00000029075|ZDB-GENE-040513-1 asic1b|OTTDARP00000047648 accn2a-001 LG_ CR450748.10 Danio rerio protein_coding KNOWN, 3282 bp
CTGGCATGCATAATAAACTAACACTAATGCTGTTTTCACA
CATTTAGAGACAAATACTCAGTTGGATTTTTTTTTAAATT
CTGAATGCATGCTTGTTTTTAGAATTAAAATGCCATGAAA
TTATGTTCTATAGATGTACCAAAACGCATTTATACACAGT
GATGAATAATGTAAATGTTAATTCTTATGTGGGCGCATTT
GATCTTACATATTGTGTGTTTGTTGCACTCATTCAAATGA
TCTGATATCAGAGCATGATTGCATTCAAATTAAAATAAAC
TGGAAAAAAGAGGATTAACCAATGCGATAGAAAAGTTCAG
TGGACTAAAATGCACCGGAGGATGAGCGCGCTCACAGAGG
AGCAGAGCGCGCGCGCCGGAGATGAAGCTCACGCTTGTTG
CTGAAGCGAACGCTACAAACACTCGTTAGTGAATTACACT
TCGATTGAATTTATGATGATTTTAATTTTTTTTAAAGTGC
AGGACAGATTTATAGTATGACAATGAACCGCGAGAGTACC
CGACGCGAGGAAAATGCCGCGACGCGCCAGTTTCTGGCAA
CAGTTGAGACTTTTATACGGGCTGTATTTCGCTTCCCTGA
GAGGAAAAATATGGAGAACTAACATTTTACAATCCTTATT
TACAACATCGCCGTAATTCAGGCACATGTGATGAATTTGC
ATCTTCCCTCGCTCCAGGAGTACCTCACCATGGTTTTTCA
GTTCAGTCATTTAAGGGGTCTCTTCTGAGGTAAAACTGTG
CGTCAAAACCCTCTCCAAAATGTGCCAAGGCGACGCACCG
CCGAAACCGCGCGCTGAAGGGTCGCTAAAAGAGGCAGGAA
AGCTCTTCTTGAAGCACACGACCTTTCACGGATTGAGACA
CGTCTTTCTGAGCGGCTCGTACCCGCGGAGAGTCGCGTGG
CTCCTGGCGTTTCTGACGGCGTTGGCGCTTCTTTTCACTT
GGTCCTCAAACCGCGTCCGGTACCTGCTTTCATCGCCGGT
GTACACCAAGGCGCATATGGTTTACGCGAAGCGCCTGGTG
TTTCCCGCTGTAACAATCTGCAACAAAAACATTTTACTAC
CGCGGCGAATGAAGAAACCGGACATCTTCAGCGCGGGACG
GTGGCTGGGGATATTCGGGAAAAACTGGCAGGTTTCAGCC
GCGGTTCGCGACGCGCTCGCATCGCTCGATGACGGAACTA
ATGTTGATCCTCCCTGGTCACCGTTTTCTCGCATACTGGA
GTTCAACCACTTTCTGCCTCCTCCCAGAGACTCCCAGCCC
TCAATGAGGCAGTTATTAGACCGTCTGGGTCATCAGCTGG
AGGAGATGCTGCTTTATTGTCGATTTCAGGGGCAGCTTTG
CGGACCGCGCAACTTTAGCACTATCTTCACGCGCTATGGG
AAATGCTACACCTTCAACTCTGGACAGGACGGCCGGCCAC
TTCTGATAACCACGAAGGGAGGAATGGGAAATGGTCTAGA
GATAATGTTGGACATCCAGCAGGATGAATACCTGCCTGTG
TGGGGAGAAACAGACGAGACCACGTTCGAGGCAGGAATCA
AAGTACAGATCCACACGCAGGATGAACCACCTTTCATCGA
TCAGCTGGGATTCGGAGTGGCTCCAGGCTTCCAGACGTTC
GTCTCCTGCCAAGAACAGCGGCTGACGTATCTTCCTCCTC
CATGGGGCGACTGTAAGGCTACGCCGATAGACTCTGATTT
CTTCAACACATACAGTATCACCGCCTGCCGCATCGACTGC
GAGACGCGATATCTGGTGGAAAACTGCAACTGCCGCATGG
TGCACATGCCCGGAGATGCTCCATATTGCACTCCGGAGCA
GTATAAGGAATGTGCGGATCCAGCTCTAGATTTCCTGGTG
GAGAGAGATAATGACTACTGCGTCTGCGAGACACCCTGCA
ACATGACGCGATATGGCAAAGAGTTGTCCTTCGTCAGGAT
CCCCAGCAAAGCCTCCGCCAAATACCTGGCCAAGAAGTAC
AACAAGACTGAGCAGTACATCTCAGACAACATCATGGTGC
TGGACATCTTCTTTGAGGCGCTGAACTACGAGACCATCGA
GCAGAAGAAAGCCTACGAGTTAGCCGGCCTTCTCGGTGAC
ATTGGCGGGCAGATGGGGCTGTTTATCGGAGCCAGTATCT
TAACCATCCTGGAGCTCTTTGACTATCTGTATGAGGTGAT
CAAGTTCAAACTCTGTCGCTGCGCCAAGAAGAAACACCAA
CGAAGCAACAACAACGAGCGAGGAGCCGTTCTCAGTCTGG
ACGACGTGAAGCGCCACGCTCCGTGTGACAACCTTCGCAC
TCCGTCGACCTACCCAGCCAACATGCTACCTCACCATCCG
GGCCAGGGCAACTTCGAGGACTTCACCTGCTGAGCGTAAC
GCAAGTGCGAACATCCAGAGAACAACCAAAGCCGACCCCA
TTCCCAACCGGACATTACCGAACAACCTCTGGATCTGCGA
TTAAACCCAGACGTCAAAGGAACGCTACCAATCAAACCAA
GTACATGTTCACATTCACCCAATGGAAGTGTGCAAAAACT
TTCAACGTTTTCTGAACTTTTAAAGGAAATACTGCCTCAA
AAATGAAACTCCTTGAAGCTTCGTAAATGTGGGAACGAGG
ATTCCCCCATGCCAAATTATAAATAATGGGACTGGGACAT
CGAATAGCTTCTTGCAGCTGGACACCGATGCCTTTTTCTG
TACATAGCGACGGCTCGAAACTGTCTTAAAGACCAGTGGC
TTACGTAGGTCAGTAGATAAATATAGCGCTTACTCACTGT
ATGTAGCCTCATTAGCCCCATCTGCTGGATCAACAGTGTA
TTTGGTGAGAATGTAACTCCCGCCGTGCGGGGGTTTCGGG
ATTCTGGAGGGTTCAGGTCCCATACGACATTGTGTTAACA
AGTCTCATCTTGTAAATGCATGCTGGTCGTCCTGTGCATG
TTTTTTTAGTTTTATTTAGACTTCATTATTATTATTACCG
CCAAGTTTGCCTCAATTATATACAGGTGTTGGAAGATGGT
GTATTCTTTTTTTGTTTGTTTGTTTATACGTGTGATTGTG
TGTGTAAGAGAAAGATTTGATGTCCTTGCTGAGATAAAAA
CTCTACAACGATACGAGAGTTCAGAAAGAAATAAACGACG
TATAAATTCACATCTAAAAAAAAATGCCAAAAATGATTGT
TATTATAATTATTATTTTAAGTTTAGAATTATGCTGTGTT
AACATCAGTCGCGGTATGTGCGGATAAATTGTGGTATTTG
TG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations