header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20076
Transcript Name: cdc34b-201
Previous Names: cdc34b-001, zgc:91847-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039830 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039830|OTTDARG00000029070|ZDB-GENE-040718-439 cdc34b|OTTDARP00000031846 DKEY-42D18.1-001 LG_ CU278516.11 Danio rerio protein_coding KNOWN, 1930 bp
CTTTAATGCTGGAGATGAAGTCTCTACAGGAGGAACCAGT
GGAGGGATTCAAGATCACTTTAGTGGATGAAGCTGATCTC
TACAATTGGGAAGTGGCGATTTTCGGACCCCCAAACACTC
ACTATGAAGGGGGCTATTTCAAGGCTCGTATTAAGTTCCC
AGTCGATTACCCCTACTCCCCACCCACATTCAGATTCCTC
ACCAAGATGTGGCACCCCAACATCTATGAGAACGGGGACG
TGTGCATCTCCATCCTGCATCCTCCAGTAGATGATCCACA
GAGCGGAGAGCTGCCCTCGGAGAGGTGGAACCCCACACAG
AACGTCAGAACCATCCTGTTGAGTGTCATCTCCCTACTGA
ACGAACCCAACACATTTTCTCCTGCCAACGTGGACGCCTC
TGTCATGTACCGCAAATGGAGAGACAGTAAAGGAAAAGAC
CGGGAATATGCAGAAATCATTAGAAAACAAGTTCTGGCAA
CTAAAGCGGAGGCCGAGCGGGACGGAGTGAAAGTTCCCAC
CACGCTGGCTGAGTACTGTGTGCGCACACGTGCCCCTGCG
CCAGATGAGGGCTCTGACCTCTTATACGACGATTACTATG
ATGACGAGGACTTGGACGATGAGAATGATGAGGACTGCTG
CTATGATGAGGACGACTCAGGAAACGAAGAATCATGACCA
CATTCCCATTGCCGCCTTCATCCTCGTCTTCATCAGCATC
AACCCCCCCGAAAGTGGAAACGTTAAGGCATGCAAACCTG
CATTTACACTCACTCAAATGGCCATTTTTGTTTCCTTAAG
GGACTAAAATGAGATCTTTTTTTGTTTGTTTCTGATTATG
TTTTTTATGTAAGCATTATTTTGTTTCACCTCAGAAATGC
GCTGGCCTTCAGGCTCTTTTCCGTTCTGCTCTTTTATTCT
TTAGTTGCTTCGTGCTTTCAGACAGCTTTGAAAAGAAGAA
AAGCTAAAACAAATGAGTGCGACTTTTGAATTAAGGTTGA
CTAAGTGAGGCTTTGTGCTGAGTAACACTGATTATGAATT
TCTTCTGATAACCACACTCACTTTTTGGCCTTCAAAGCAC
ATTTGAGCAGCCCAGCAATCAAGTGTGACTTTGTCTTATT
AGGTAAGCTTTATTTTTTAAGTAGAAATTCCAATGAGAAG
CCCTAAGCATAAGATTAAAGTATGAAACCTTGATATTAAT
CCATCTGCTGAGGCCTAATTCTACAACGTGCTTAAATTCC
ACATTATTTATCTTATAGTATCACTTTAAATTATTGAAAT
GATGTATTTCTCTGTTCCAGCATATAGGAGCTTATCAGAA
AATCGATATAATCAGATTTGGGCTGGATAATGTTTTGCTG
TTGAGCTGAATTTATTTTAATATTTTCTTTTTTTTTTAAA
GCAATGCTGATATTCCCGTCTCGTCCTCTGTAAATCTTAT
TTAACTGTAGTGAGATTTTTTTTTTTTTTTTTCATTTCGC
ATCACTGATCGTTTGTTGTTTTGTTTGGGATGTAGCTCAA
AAACTGTTGAACTATTTTTTTTTTTTTTTGTGGCGTTTCT
TTTGCGTTAATGTTCTGTGAACCCACGGCACGTTCTTAGT
TGTGAAAATTTCGATTGAAACATTTGTTTTTTGCGCTGCC
TGGAGGCTTGCAAGTGCTGGCGTCCGTCTCTGATTTCAGC
TCATATCGACTGACTCTCAGGATCAACCAATCGGGAAAAA
GAAAAATCTGCCAACAACATTGCGTACTTTTCTTTTTCCC
CCCCGCATCTGCAAGTCATCCGTCTTTATGATTTTTGTTT
TAAGGACAATTTACAACCGTATCCCAAGAGGCTGAGATCC
ACACGTGGAGCTGATTTGTCATTTTATTGACCTGTATGTA
TTTTTACGGTTTGTTGGCCTATTTAAAACTGAATAAAGAT
CTTTATTAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdc34b-201 Contained in:
[BAC] DKEY-42D18 (1) (order this)

OTHER cdc34b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039830 (1)
  • Ensembl_Trans:ENSDART00000143471 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076537 (1) 2465 bp
    CITATIONS (2)