header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20066
Transcript Name: map6d1-201
Previous Names: map6d1-001, si:ch73-60l17.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039819 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039819|OTTDARG00000029059|ZDB-GENE-081104-293 map6d1|OTTDARP00000031835 CH73-60L17.2-001 LG_ CU467875.8 Danio rerio protein_coding NOVEL, 938 bp
ATGGCTTGGCCGTGCATCAGCAGAGTCTGCTGCTTGGCTC
GGTTCTGGAACCAGTTTGATAAATCTGATTTGTCGGTTCC
GTTAACCATCCAGAACTACTCGGACATCGCGGAACAGGAG
GTCCGGTCCGTCACCAAACTCGTCTCCACGGAACAGGCGC
CGAGCGTGGAGTTCACCGCGCCGGATCACGCCGCTGGAGT
CCGGCGGTCGCACCGTGGACGAACAGAACCCAGTTACAAA
CCCCGTGAGGACTACCAGCCCCCGGGTGTGCCTTTCCCCA
GCGTCACCCAATATAAACAGGATTACAAACCCTGGCCCAT
CCCGAAGAAGGATAACTTTCCCTGGATTAGCAACGGAGGG
AAAGGCGGCAGTGTGATGGACAGCCCGGTGAACGGTTACT
CTAACGGCACGAGTCAGGCGCGGGCGGACAGACAGGAGCG
CAGTGGCAGACCGAGAGCCGGAGATCAGATGAGCTCATAC
AGACAGGAGTACCAGCCGTGGTCTGGAGCACGACCGTCAA
AGCCTGCCCACAAACGGCCCACTTTCCTGGGCACAGGAGG
TGCCGAGCCGCCGCCAGAGACCAGCTATCAGGCGGCCTTC
AGCACAGACACACACAGACAGACGGACGGCCTGCCGGACA
CCAGCAGCACACACACTGACAGACAGAGGACAGACATCAG
TGGCAAACTAGAGGAGCAGAAGACCAAGCTGTCACCAAAC
CCATCTGCCGTCTTTCAAAGCAAATCCAGGATCTTCAACA
TATGATCCCATAAAGCTCCAAACATAAAGAGCCACATTTA
CATCGGATTCAGCCTTTAATTCACTACAAGAGGAAACCAT
ACAAAAAATAAATAAATAAAAAAGATGGAATGTCTAAAGA
GACACCTGAATGTTGAGAAACTGGAGGATAATCAAAAGGA
AAACATGATGAAAAGAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
map6d1-201 Contained in:
[BAC] CH73-60L17 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039819 (1),  Ensembl_Trans:ENSDART00000146380 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DT069306 (1) 835 bp
CITATIONS (2)