Transcript

zbtb47a-202

ID
ZDB-TSCRIPT-090929-20014
Name
zbtb47a-202
Previous Names
  • zbtb47a-001
  • si:ch211-145c23.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039763 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039763|OTTDARG00000029020|ZDB-GENE-081104-121 zbtb47a|OTTDARP00000031792 zbtb47a-001 LG_ CU464125.6 Danio rerio protein_coding KNOWN, 3714 bp
ATTCATGTTTAATGGAGAAAATCAATGACAGATTTCAAAC
GAAGCATGATGCTGTCGAAAAAATAAAATCTTTTATTAAA
AACTCGCTGTGTTATAGCGCCAGCTGGTGGCCGCGCCGTT
GCTCTGCAGGCGGTGAACCGGTTCACTCGGCGGTGGACTC
GCTGACCCCGCCGCTCCGCCTGTGCCTTCAGGAGCTCCGC
GCCTCTGACTGCGCAGCGGCCGCCAGGTGCTCAAATAGAC
ACTTGAAGACCCCCCCAAAATGCTCTTTTGCCGAGCGGGT
ATACGACCATTTGTAAACATAATATCTCTCCGAAAGCTGC
AGACTGTGGAAAGCTCCGTCCTTTTAATCACGTCCCTGTC
GCTTTAAAGCTCCAGACAAAACGACCCATATGATTTTCGA
CCTCCAATCATCATCTTCATCATCGTCATCATCATCACCG
CTCTTCTCATGCGGACATGGCGAAAAAGCACAGCTGTCTT
GAGAAGAAGAGTGGATATATAAATGACAGCGGTTTTCCTG
CAAACAGAGCGGTGAAATGCTGAGCAGAGCAGCCGCTTCT
CCTTCGAGGCAGAGACCGCTGGATCATCATGCTGATTGTG
GAGAAGACTGCCGATCACCCGTCCGTGGAGTTCTCCATCG
TTGAGGACGTGGCCCTTCACTGCACCTTCCTGATGGACAG
GCTGAACGAGCAGCGCCTCTTCCAGCCAGATCTGTGCGAC
GTGGACATCGTCCTCCTGCACCACCACAAGTCCTTCCAGG
CTCACAAGGGCATCCTGGCAGCCTTCAGCCCTTTCTTCCA
CTCGCTCTTTGCCTCCAGTAAAGACCTGAGGCGTGTGGAG
CTCTCGCTGGACGCCCTCAAACCTCAAGGCCTACAGCAGA
TCCTCAACTTCATCTACACCTCCAGGCTGCTGGTCTCCGG
CTGCAATGCTCAGGATGTCCTGAGAGCTGCCACTGTGCTC
CAGATGAGCAACATTGCTACATCCTGCAGCGAACTCATCT
CCCGAGGCTCGGTGGAGATCAGTGTCAAAGATCAGCAAAA
CAAACCTGAGGGCAACTGGAGCGATTCGGTGAAGGACATC
AAGCAGGAGAAGGACACAACGTGTGCCAGGATCTGCGGAG
GGAAGAGTGAAGGAAACCCGTATTCTGTTCAGGTTGCAGA
TTTGCAGTCGGTGCAAGGAGGTATTTGTAAAGTGGAAGGA
AAGGAACCGAGGAACCCTGAAGATCCTGATTCATTCAATG
GAGAGCAGATTATTGTGGAATTAAATCTGAATAACCAGAC
TCTGAATGTGTCGAAAGGTTTGGATGGAAGCTCAGCAGCT
CAGTCTCCATCGGGACAGCAGCTTTCTGGAAAAGAAAAGA
GCAGTGATGGGACTTTTGAAGAATCGAGAAACAATGTGAC
TTTGGAGGAGGAGGAAGAGGAGGAGGACGGTGAGCAAAGT
GAAGATGAGGATGACGATGATGATGTGAGACTTGAAGGCA
CTAGCGAGGATGAAGGCGAGTCTGTTTTTTTGTCGGAAAT
GAAGAGCCGGGCCTCTGCTCCACTGGTCTCCAAGAGGAGC
TGTGCGAGAGCAAGGCAAGAGACGGATCGTGATCCTAGCG
AGGAACGTCTGGATCAGGACGGTTTTGAGAGCTTCAGCTG
TCTGAGGTGCCCGAAGACGTTCAATAACCGCTGGTACCTG
GAGAAACACATGAACGTCACACACAACCGCATGTGTGTCT
GTGAGAAGTGTGGCAAACGCTTCCTCCTGGACAGCGAGTT
ACTGCTGCATCAGCAGACTGACTGCGAGAAGAGCATTCAG
TGTCTGACTTGTGGAAAAGCCTTTAGAAAGCTGTGGTCGC
TTCATGAGCATAATAAAATCGTTCATGGCTACGCCGAGAA
GAAGTACACTTGTGAGATCTGTGAGAAGAAATTCTACACG
ATGGCTCATGTACGCAAGCACATGGTCGCCCACACAAAAG
AGATGCCATTCACCTGCGAGACCTGCGGCAAGTCCTTTAA
AAGGAGCATGTCTCTGAAGGTCCACTCGCTCCAGCATTCA
GGAGAAAAACCTTTCCAGTGTGAGGTGTGCAGTGAGCGTT
TTCAGTATAAATACCAGCTGCGCTCTCACATGAGCATCCA
TATCGGACACAAGCAGTTCATGTGTCAGTGGTGTGGGAAG
GACTTCAATATGAAACAGTATTTCGATGAACACATGAAGA
CGCACACAGTCTGCTGGCTCTTTTCAGGAGAGAAACCGTA
TATATGTGAGATCTGCGGAAAGAGTTTTACAAGTCGACCA
AATATGAAGCGGCACCGGCGTACACACACTGGAGAGAAGC
CTTACCCCTGTGAAGCCTGCGGTCAGCGTTTTCGCTTCTC
CAACATGCTGAAAACTCACCGTGAGAAGTGTTTGCAGGTC
AGAAACCCTTTGCTGCTGGACTCCTCCACCATTGTCAATC
ACACAAACCAGGACCTGCCGGGGGGGATGGAGACACTGGG
GGACGTCAGCCCACATCTGCACGGCATGGTCTCTTTTCCA
TCATCTGTGCTTCACTCGGTCGAAGGAGCACCGTCAAATT
CTCATCTGCGTTCTGTTATGCCGCTCTTCTCCACTGGAAG
GACAGACTCCAGGATCCTGTAATGACTGCTTTGTATTTTT
ATATAATTTCATTGTGAGTTTGACATTTCATGTTAGTGTT
GTCTGTTTCATGAGTCTTATTCTGAAATCCCTGTCATTCC
CATTTTGATGGAGTCCTCTGTGCTTTCATAAACCCTAGTT
AGACAAACAAGTATTAGGGAAAATGCTAAAGGTATTACCC
AAATGTAGAGTACTAAATGTTTGACATTTACTCTTCAATA
TGCAGTATATTTGTAGAATTATAAATAAGACTAAAGCATA
TTCATCATGGCAAGTCTTTTTAACATTACACCTATTAAAC
ACAGGTTGATAACTGGCAGAGTGCAGTCAGGGTTCTGCAC
CCAGAAGCTGTCCCATACAAACCCTACAGCCTTGAGAGGT
CTGTGCAGGATTGTTTGTTTTTTTGTTCCGCTCCCGCTGG
GCCTGTACAGCTCTCTTCTTTGAGTGACAATGACTTAATC
GCAAGTTTCTGGCTTACACTAGGCCTACGAATTATTACAA
ATATAATAAAACATTATACAAATGTTAACTATGTTCATAG
TGAGCTATATTCACATTATCTAATTACTTACAGTACATGA
CAGAAAGCATAAGCGCTGTAAAAAGTAGCCTAGAGCGCTA
TCTGCTGTTAAAGCTCAGAAAATCAATATTACAGAGAGAA
TTGCGTTAGTTTAAAAATCAAATTCAAATCCATCAATCAT
AAAACATTAATTTATTATCCCAGCACTAGTATCTTTTAAA
AAGGTACTAGTAACTAAATAATAAGTACTTGTATCTATTA
ATAAGTAGACTTAAAATGTACTAACTAAACAACAAGCACT
ATATCTGTACTAAATGGATTGCTATTAAGTATAGTATAGA
ATAATTGTTAAAACGGCTTGGCATGTATTCGGTTCATAAA
GCTTTCAGTTTGTAATTTATTGTTTGTAGATGCTTTATTT
CATGTCTTCGTTTGTTTATAGGCCCAAGTATTGTTTGACT
TTAGAGGGTGATATCCTGTTGTATGTATACACACAGGTCT
TGATGAAGGAAATGTTCTGTCAGATTAGCTCGTTGGTGTA
AAGCAGGGGTCACCAATCTCGGTCCTGGAGGGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations