header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20006
Transcript Name: cryba2b-202
Previous Name: cryba2b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039755 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039755|OTTDARG00000029016|ZDB-GENE-040718-324 cryba2b|OTTDARP00000031787 cryba2b-002 LG_ CU468956.14 Danio rerio protein_coding KNOWN, 840 bp
CTGCTGCTGAGTGAGCAGGCCTGATGCGCATTCGCCACTG
AATGAGGACCGCTGTGCTATAAAAACACTGGACAAGGGCT
TGGCCACCACATTGATTATACTGGATCTGTCCCACCTCAA
CAAGCGTGGTGATCGACAGCAGCCATGAATCCGCAGGAGC
AGTTGGAGCAGAGGGGAAAGTTTCGGATGACTGTGTTCGA
GGAGGAGCATTTCCAGGGCAAGAGCTGCGAATTCTCCTTC
GAGTGCCAGAACATTCTGGAAAGAGACTTCAGGAAGATCC
GCTCCATTAAGGTGGAGAACGGACCCTGGGTGGGGTACGA
GTATCCTGAGTTCCAGGGCCAGCAGTTTATCCTGGAGAAA
GGAGACTATCCCTGTTACCAGGCCTGGAGCGGCAACAGCA
GCTACAGAACAGAGCATATGCTCTCTTTCAGACCCATTAA
ATGTGCTAACCACAGCGACAGTAAGATAACCCTCTATGAG
TGTGAAGACTTCATGGGCCGTAAATTTGAGATGTGTGAGG
ACTACCCTTCCATTCAAGCCATGGGCTGGTGCAGCAAGGA
GGTTCCCTCAATCAAAGTCAACTCTGGAGCCTGGGTAGGC
TATCAGTTTCCCGGTTATCGTGGATATCAGTACATCTTCG
AGAGAGACAGACATGAAGGAGAGTACAGATGCTACAATGA
CTTCGGCACCCAGGCACACACCAACCAGATCCAGTCCATG
CGCAGAATTCAGCAATAAGAGAACAATATGTCATGCCGTA
TCAATACTATAGGCAATAAAGACATTTAAATGCTTGTGGC
AGTTCCTTGCTTTTTAAATAAAACAGCTTTTCTGCTCAAA

cryba2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cryba2b-003 (1) 854
cryba2b-004 (1) 715
mRNA cryba2b-201 (1) 803
cryba2b-202 840
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cryba2b-202 Contained in:

OTHER cryba2b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039755 (1)
  • Ensembl_Trans:ENSDART00000127942 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ136042 (1) 741bp
    CITATIONS (2)