Transcript

si:ch1073-349o24.2-201

ID
ZDB-TSCRIPT-090929-19982
Name
si:ch1073-349o24.2-201
Previous Names
  • si:ch1073-349o24.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039724 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039724|OTTDARG00000028999|ZDB-GENE-081104-83 si:ch1073-349o24.2|OTTDARP00000031765 CH1073-349O24.2-001 LG_none CU693367.4,CU855774.7 Danio rerio protein_coding NOVEL, 4816 bp
GAATACACAACTGAACTGAGAGGGTTGCAATGTTGACAGA
TCATCCCGTGAATCCTCTGAGCTCGCGAATCCCCTTTGGA
GTCCCAAACAACCCACACAGAAAGAGGGTCTCAAGCCTCA
AGTCAGGATTTATTCAGAAGAGACCCCAGAACTGCTTCTT
TGGTGTAGAGACCTGGGCTGAGCTGGTCTGGGAGTACTGG
GAGCCGGGGCTAGAGTATACCAAATCTCTGGTCCTTAAAA
GCATACATGGAAAACTCCAGAAACTCACATTCAGGCTACC
TTCATCCAAGTTGTTCAGCACACCATTTCCTCAGACTATC
CTTCTGAGCCCAGGAACATCTTTCTCACTTCCAGTTACTT
TTCACCCTCTTGAGAAGTGTGAATATGTGGACGCAATAGA
GTTTGAGTGTAAGGAAGGCACATTCCAGGTGTGTCTACGA
GCTGTGATTCCCCATCATGCTCTGGACGTACCAGAAACAG
TGATTCTGCCACCCTGTGCTGCTCAACAATGCTCTCAAAC
CAGCTTCTTCTTTAGGAATTCCAGTAAGCTTCAGACAGTA
TTCAGGTGGTTTGTGGATCCTCCGTTCCAGCTGTCTCCTG
AAACTGGACAGCTAAACCCTGGAGAAGAGTGCAGGGTTAC
AGTAGAGTTTAGACCTCAGCAGGCTCTAGTGTACCAGGCT
GAGGCCAGCTGTGCATTCGGGGATGATGGCGAGAGCAGAT
GTGCTGTGCTTCTCCGTGGGCTGTCCAAGTACCCGCACCT
CCAGATCAGCTCAACGGGTCAGGAGGAGGGCTGTAAGGTG
CTGGACTTTGGCAGTGTGGCAGTTGGAGAATTTCTTGAAA
AGCACTTTGAGATCCACAACCCCTCCACTGTATCATTCAG
TCTGTCCTGGATGAGACGACCCACTCTCATGGAGTCTGTG
TTTCGCTGTGAGGTGTATGAGGGGACGATCGCACCTTATT
CAGTGTTGAAAGTCCCTGTCTGCTTCTCTCCACTCACAGT
GGAAAGCATAAGTGTAGACTACATCAGACTTACCTGTCCT
GGGGCTGTAAATGAAGAGCTGCTCAAAGTGTCTGGCACAT
GCATAGGTCCAATAGTATCTCTAAGCACCTCTGTACTGGA
CTTTGGCTGTGTAGAAGAAGGCTCAGAGATGTCACACAAT
GTGCAGATCATCAACTCCTCTGCAGTATTGGCTCATTACC
AGTTTGATATGGACACTGGGGGACATAGTGTATTCAGTGT
TGATAAGCCTTGTGGCATCCTGGGTGGCAGCAGCAAACTC
AACCTGCGTGTGAAATTCAGACCACACTGTTCTGTAGCTT
ATCATAAGACTGTGACCTGTTTGCTGATGCACAGGGAGCC
ACTGTTTCTGGATTTGATCGGCACCTGTCACTCAGAGCAG
TTGAAGCCAGCCATTTTAAACCCCGGACATCTGAGTGCCT
ACAGACTAAATCTACTACAAGGGCTCACCTGTTACCCTCC
TGACTTACTAAGTACCTTGCTGGAAGAGCAAAAATTGAAA
GTGGATGACAGTGGAGCATTGGTAATACAGGAGTTTCCAG
CAGATACTGTATATCCCACACGTCTCTTCAACCCACGCAG
TCCTATAGAGGAGTATTTCCATGTTAATTTAGCACCTGAA
GCAGAAACAGAACTTGGCAACAACTCATCCAAATTCCCCG
TTCACCATGTTACCGTTCAACCCTCTCAGCTCCTGTTTTA
TGATGGCCCAGCGTCAAAGTCAGTCTCCATCACCAACCAC
ACCAAGGGCAAAATCTGTGTGATGTGGTCACCTGGAGCCA
AATCCTCTTTCTCCATCTTTCCTCTCTCCTGTGAGCTGGG
CCCTTTAAAGACCACAGCCTTCAGAGTGACGTACAGTCCA
AACCAGCAGAACATGTTCCATGCAACACAGCTGGAGTGTT
TCACATTTTACAAGGTCTTGAAAAATCATAGAATTGTGGA
AGATCAGACTTTATGCCCACCCTGGTGCCTTACAGTCAGA
GTAACTGGCCACTCATTTCAGCCTGGAAAAGAGCCCTTTG
TCCCCAAATTCTCTCTTCAACACTCTCAAGTGGTATTCCC
CGCACTGAAACGGGTGTCATACCGCACTGTCCTATTACAG
AATACAGGGGACCTACCTTTGATCTTTAGATTGGATCCCG
AGGAGTGCCCATCAGTGTGTGTACTGCCACCCAGTGGTCT
GGTGCCACCAGGCAGTCACCAGATCCTCACATTAAGATGC
TCTCCATCACCAGACCACCCTTCTAGGATACCTTTGACAT
TACATCTGAATGCCAGCCCCAATCACACACAGGTACTGAA
TGTGGTTGCTGTAGCGGAGAAGCTTTCGGTGAGCGTAGAG
GGCGATGGCCGTCTGTTCTTTCAGCCCACAGCAGTGAACT
CCTGCTCTGAGCAAACCCTGCAAGTGAAGAACACGAGCAC
CGTGCCGCTGGAGTTCAAGTGGAGGCTGTGTAGATCTGAC
CAAACTGTTCTGACTGTACTGCCCGACACAGGCGTACTCC
AGCCCAATGAATGCAAGGTACAGAAGTGGTCCTTCACTCC
AAAGGAAGAGATGATGTACAATATGAGGCCCTGTCTCACG
TTCTGGCCTGTTCAAGCACCACAGATCGAAAAGTCCCGCT
TTACAGTTAAAGCTATAGGATTTGCATCCAAATGCTCTCT
CCAGGCAGAGCAGCCTGTTATAGATCTGGGCGAGGTGCTG
GTGGGAAGCTGTAAGGCATTTGATTTCCCTCTACTGAACA
ACAGCCCCTGTGCCGTGAGCTACTCTCTGACCACACAGCA
GTGCATCAGTGTTACAGGCTTTCCTGAAGAGATGACTCAA
GATCCTCAGGTTCTGGAGATGGAGAATGCAAAGTGGACCA
TACCTGCTGACTGCAGAATACTAATTCGATGCACAGTGAA
ACCAGCTCTCAGGGCCCATTACTGCTGGACCATCGGTTAC
CATGTCCTCAATGTTTCTGGCTCCACTGGAGAAGACCAAC
CTCAAACTATATGCAACGTGCAGGCTGAAGGAGTGTATCC
CTCCCTGGAGGTGATGGATATCCGTAGCTGTGGAGGTTTG
GATGGGCTGAGTAAACTTCAGCTGTGGCGTCTCTTTAATC
TGGATACACTCAACAGTAATCTGCGCAGAGATCCCAGCCC
ATCTGAACTCACCTTTAGGGTGCCCACTAGACATAGTCTT
AGACGTTGCCCGTCCATCTTCACCTCAGCCATAGTGGATT
TTAGCTTCAGCGCCTCTCCCTTGGGATCAGAACCCTCCAG
TGTTCTGCTTCTGTTTAAAAACCCAGGAAGCATTCCTGTA
GAATGGTCATTCTTGTTCCCTGAGGACCAGCAGATTGAGC
TGGATTATTGGGCTGAATCTGGAGACTTCAGTGCATCTGA
GCTCCACTTGATGAAGATTCAGGACCACAGGCTCTTCTCC
ATCTCTCCACGCTCTGGTAGACTCCAGCCCGGCCAACAGA
AGACAGTTCAATTCATGTACAGACATGACTTTGTGGGAAC
AGATCGTCTTCCTGTCCTGTTGAAACTTTCACATGGAAGA
GAGATACTGTTGAATTTTATAGGAGTTACTGTAGAAAGAG
ATCGGCGCTACATTCACCTCTCCTCCAATCGGCACATTTT
TGCCCCAGTGCCCATTGGATGCTTCAGTCCTCCCAAACAG
GTGTTTGAGTTGTATAATGCAGGCACTCTCCCACTGAGGT
ATCACATGGACACTACTCCACTGGAGGAGCTGATGGAGGA
GAACTTCAGTCACCCGGTCCTGCAGTGTCTGAATCCTGCT
GCAGAAGTGAAACCAGGCCACAGCGCCATGCTTGAGTGGA
TCTTCTCCCCACTGGAGGCTAAAACATACACCGTGGATGT
ACCAATTCATGTGGTGGAAGGGGACAGCATGTTTGTAACT
TTTGAGGGCCAAGGCTTTGATGAAAGAGAGTCTGAACCCA
TTCAAATACAGAATGGGGGAATTACTGTGCCTAGCATCCA
AAGAATCTCAGTACCTGGACAGGTGGTGTACCTGTCAGAA
GAGAGAGTGTGTTTTGGTGACATCCCCGTGTGTTCTCGTA
GCACACGCATCCTTTTTCTGACCAACATATCAAACACAGA
TGAAGTTTTGTATAAGTGGAACATCACAAGCACTGAATGC
AAGCAGACTATTAATATCCGTCCTGAGAGTGGTCATCTTG
CACCAGGACAGAGTGTTCTCTGCATCCTGACAATACAGGC
CTCGGGCAGCCCCACTTTCTACCAAGAAGATCTCATCTGT
GAGATAACTCTGCTGAAGATGCTAGCACAGTATCACAAAG
ACCTGCGACAGTGGGAAGAGGAGACAGAGAGGCAGAAATA
TGAGTTTACCATCACTGAGAAAGACATGATACAGTCAAAC
CAACTAAATAAATACACTCAGGAAGATGCAGTGTTTGAAA
AGAAAACTGGCACAAGAAAATACAAGACCCTTCCACCCAT
TCGTAGTAGTGATCAAGCTGTTAGTTGTGCCACAGCGAAA
CCCAGTCGGGCTGAACAGCGAGCCCGGCAGCACACAGGCC
AGGAAAGGAGAAGACGTCCTGAGCTACCTCGTCCTGCTTT
ACTACACTTGGGTGTCACTGCACGCTCTCACAGCCTCTTG
GAGTACCAGACACATTTCCCTACTCACTTCAACACTCATT
ACATTAACAGATCTAGGCAGCCAAAGGATTCTTCGTCTGG
CACAGCTGAAAGCTTTTATCATCCCTCAGAACTTACTCCT
CTTGGTCCTGGTCATGAGAGAGACATCGTCACGCATCTGC
TCACCTCTTTGCTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations