Transcript

wdr33-203

ID
ZDB-TSCRIPT-090929-19955
Name
wdr33-203
Previous Names
  • wdr33-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039697 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039697|OTTDARG00000028984|ZDB-GENE-040924-3 wdr33|OTTDARP00000031744 wdr33-001 LG_none FP016178.5,CU571377.3 Danio rerio protein_coding KNOWN, 4793 bp
CTGAAAGGGAAGTAAACATGCAGTGACGCAGTTGTCCCGC
CGATACGTCTGACGTCACGACGTCGTTTCGGAGTTCACAG
CAACAAGATGAGAGAGGAAGCCTTGAGATGGAGGCAGGGG
GGTGATTTATCGTAAAAAAATAGCGAATTTGGAGACAGTT
GACATTCCGTTTTCAGAAAGAGATGTAAAAGTCTCCCCAA
GGAAGAGTCGTGTGTTAAATTTAGCTATATTAATACTCAG
TCAGCACTGGATATTTGGGTGAGTTCCTCAAGTATTGACC
GGGCGCCATTTAAACACGCTGTGCGGGAGACAGGAAAGAA
ATAACCGCTCTCACAGCCCGCACTCGGCTTTCTGCTTCCG
CGGACAGATTCTGCTCTCTAATAAACACACTTATTTGTTA
GGAGATTGTATTCTCAGTGTGGTAGGCAGTAGAAATGTGG
CCTGTTTGTGAAGGCCTCTGGTAGCACCAGGTATTGTGTG
TGTTAGCTGGCTAACGGCTAACAGACCTCGAACTGAAGAG
AGTTACGACCCCGAGCAAGAGACTACAGGTGTACTAAACC
GTGACCATGGCGACTGACATCGGCTCCCCTCCGCGGTTCT
TCCATATGCCTCGCTTCCAGCACCAGGCTCCCCGTCAGCT
GTTCTACAAGAGGCCCGACTTCGCCCAGCAGCAGGCCATG
CAGCAGCTCACCTTCGACGGCAAGCGCATGAGAAAAGCCG
TCAACCGCAAAACCATCGATTACAATCCATCCGTCATCAG
ACATCTAGAGAATCGATTGTGGCAGCGAGATCATCGAGAT
TTCCGTGCTGTTCAACCAGACGCAGGCTGCTATAATGAAC
TCGTTCCCCCAGTGGGCATGATTAGCAATCCTATGAATGC
TGTCACGACAAAGTTTGTCAGAACCTCCACCAACAAAGTC
AAATGCCCTGTGTTTGTTGTGAGGTGGACTCCTGAAGGCA
GGCGACTTGTAACAGGTGCCTCCAGTGGGGAGTTTACTTT
ATGGAATGGGCTCACGTTCAACTTTGAGACAATTTTACAG
GCTCATGACAGCCCTGTCAGGGCAATGACCTGGTCTCATA
ATGACATGTGGATGTTAACTGCCGACCATGGAGGTTATGT
GAAGTACTGGCAGTCCAACATGAATAACGTCAAGATGTTC
CAGGCTCACAAGGAGGCGATTAGAGAGGCCAGTTTCTCTC
CTACGGATAATAAATTTGCCACTTGCTCTGATGACGGAAC
TGTTCGCATCTGGGACTTTCTGCGCTGTCACGAGGAAAGA
ATCCTGAGAGGTCATGGAGCAGATGTGAAGTGTGTGGACT
GGCATCCCACAAAGGGCTTGGTGGTGTCCGGCAGCAAAGA
CAGCCAGCAGCCCATCAAATTTTGGGACCCAAAGACTGGA
CAAAGCTTGGCAACACTACATGCACATAAAAACACAGTCA
TGGAGGTGAAGTGGAACCTCAATGGCAACTGGCTGTTGAC
AGCATCACGAGACCATTTATGCAAACTGTTTGACATCCGC
AACCTCAAAGAGGAGCTGCAGGTTTTCAGAGGACACAAGA
AAGAAGCCACAGCTGTGGCCTGGCACCCAGTTCACGAAGG
CATGTTTGCCAGTGGAGGTTCTGATGGATCACTACTGTTT
TGGCATGTTGGTGTGGAGAAAGAGGTTGGAGGAATGGAGA
TGGCACATGAAGGAATGATCTGGAGTTTAGCCTGGCATCC
GCTGGGCCACATTTTGTGTTCTGGGTCTAACGATCACACA
AGCAAATTTTGGACGAGGAATCGGCCTGGGGACAAGATGC
GGGACAGATACAATCTAAATTTGTTGCCTGGAATGTCAGA
AGATGGGGTGGAGTATGATGACATGGACACCAATAGTATT
GCAGCCATTCCTGGCATGGGGATCCCAGAACAACTGAAGG
CAGCCATGGAACAAGAACAATCAGGGAAAGACATGGTGGC
AGAGCCTGAGATGAGCATCCCGGGGCTGGACTGGGGCATG
GAAGAGGTCATGCTGAGGGACCAAAAAAAGGCCCCGACTA
AAAAAGTTCCTTATGCAAAACCCATTCCAGCTCAGTTCCA
ACAGGCCTGGGCAGAGAATAAGGTTCCGGTGATGCCTGCT
GGAGAAGTTCCAAAGGAAAGGAAGGATGAGAAGAAAGTAG
ATAGCAAGAAGAAGACGCAAGCAGAGATTGAGCAGGAAAT
GGCTGCCCTGCAGTATACAAACCCAATGCTGCTCGAGCAA
CTGAAGATTGAGCGAATGGCACAGTTGCAGGAGCAGGGAC
TTCCTCCCCCTACTGGACAGCAGTCAGGACCAGTTCCGTC
CTTTCCAGGGCAAGGTGGTCCAATGCCTCCTCCAGCACAA
GGCTTCCCTCAGTCCATGCCTCCACAGCAAACACCACACA
ACATGCCTCCTGTTGGACCAGGGGGGATGCCTGGTCCATT
CATACCTTCAGGCCAAATGGGCCCACCGGGACCTCCCATG
CACCAGGGTCCGCCTCCACAGGGCATGATGGGACCTCCAG
ACATGCATGGACCTCCACGTCATCCCGGCCCTCACAGGAA
CATTGGACCCCAGGGTCCTCCTGGCATGCCGCCAGGCCCC
AGAGGCATGCAAGGACCTCCCCCAGGAGGGATGCACCCTG
GCTCTGGTGGACCTCCAGGCAGTATTATGGGACCACCGCC
ACGAGGACAGGGTCCTCCACAAGGAAATATGATGCATCAG
GACATGAGGGGGCCTGTGCCCCATGGAAACATGATGGGCC
CTCAGGGACCCATGCAAGGGGGTATGATGGGCCCTCCGCT
CAGGACTCATGGCATGGGAAATATGCATGGGATGGGACCT
CCTCCTGGGGGTATGCATGGACCACCAAACAACATGCAAG
GGCCACCAGGAAATATACAAGGACCTCAAAGCAGCATGCA
GGGCCCCCCACCATATATGCAGGGCAAACCCCCACACATG
GGTGATGGAAATCGAGGACAGTTCAGCCAGGGTCAGAATC
AGCCAATCATGCATGGAATAGGACAGCAGGGTCCTAACGG
AAAAGGTAATGCTCTGAATAGTGAATGCTTCAGTGTTGAT
CTTATGCAAAGTGATTTAATCGTGACATTTGACCCCTTTC
GCTGTCTATGTCAGATGGTTCACGAGGGCCACCTAACCAC
CACATGGCTCACCCACCAGAGCGACAAGGCCCCGGAGGAC
CTAGTCAGAGCTCAGACGGAGGCCAGTACTGGGGGGAAGA
TGGGGGTTACCAAGAGGGCTGGAGAAGAGGCCCTGGAGGT
CCTGCACAGGAATACTCTGGAGGTCACAGAGGAAACTCTG
GAGGCCAGTGGGAAGGCCAGGAAAGGTTTTCCACACGTGA
TGAAGAGTTCATGGGGTATGATGGGTACGAGGGCTCTGGA
GAGGAGTTTGAACAGAGGTCGAGACGACAACCCCATGGAG
ATGACTCATACCGGAGAGGTGGCCCAAATGTGCGTGGTGG
GATGGGGGGCTACCAAGATGAGTATGGTGGAGATGAGAAC
TTTGACTCCCAAGAAGAGATGGGCCAAGGTTGGGGAGGAA
GAGGGAGACCGCGTGGTGGACCAACAAGAGGAGGTCATGA
GGGTTATCGGGATGGTCAGCGGCCAGACCACAACATGCAT
GACAGTCCTTCCCCTGCCAGTAGAGAGCGTTCGTCTTCTC
TACAGGGCATGGATATGGCCTCACTGCCTCCACGCAAACG
CCCATGGCATGATGGCCCAGGCACTGGCGACATGGACTCT
CCTGGTTCAGGACCTGATGAAAGAGGAGCTGGTCGACCAA
CCCCAAGAGATGAAGGTGGGTACGGGCCTCCACAACGAGG
CGGGGGAAGAGGTGGTTGGGGTCGTGGTGGGCTGCCTAAC
CCTGGTGGCCCCGGTTCCAATATGGGTCCTAATCTCAGAC
GAGGTGCTCCACGGGGTGCTATGAGGGGCGGTCGTGGGCG
GTAGAAACAGTGATACCTGCTTTCCTGCTCACAAGAAGGT
GAAACCGAGTACACTGAGGACAGAGCACAACAAAGAACCA
CACACGGCAAGAACACCAGCTTCCTTGAAGGTCTTAAATG
GTGACTGGAAGCAGCACTTCAAAGGAAAATCAGCTTCTCA
GACTGGTGGCTAAAGTTGAGCTTTTTCTCTACAATGTACT
GGATGGAAGGTGAAGCGGTCATCCTAGGCCAGACGCTTTT
GGCTCTGATGCTCCTTGGCACCTGCTTGGCCCATACATGG
TGGTATACAGAACTTGATATCAACGATGAGAATAATAGCT
GTAATGGTGCGATGAGAAACATCATCTCTTGAAATGGACT
TGTGTTTGTGGTCCAGTAGACTTTGCGATGCATGCTTCAG
TGTGGAAGCTGAAGAAACTGAGCAGCTTTATTAGACAACG
AGAAACCGAGTTTGTACCAGCACCTGAGCCTCCGTTTTTT
TGTTGTTGTGTACTTTAGATATTCTCATAAAACAAAACCA
TTGCGTATCATTGGATTCTGTCACCTAGAAAATGGAAGTC
AAGCTAGAGCCAACGTTGAGCAGGCTTTATCTTGAGAACT
CCCAGAGAAAAGTGAACTTTCGAATGTTTTGTTGCCCCAG
CGCTGTTTATTTAATTTCATTTTTATGTAAAATAACGGAG
ATAATCTTTCTGTAACCTTACCAGGCTACTCTCGGTGACA
AAGCTTCCGACTTTGTTTCTATTTGTACAGTTTGTCACAG
AAGTTGTCATATTGTTTTGTCCTTTTTTTGTATGGAAACC
ATAATAGAATGTGCAAAATTTATGTAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations