Transcript

zgc:113340-202

ID
ZDB-TSCRIPT-090929-19931
Name
zgc:113340-202
Previous Names
  • zgc:113340-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039669 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039669|OTTDARG00000028966|ZDB-GENE-050327-34 zgc:113340|OTTDARP00000031720 CH73-262H23.2-001 LG_ CU595952.10 Danio rerio protein_coding KNOWN, 3690 bp
ATTCCTGTTCGCGCGTGACGTCAGAACCGATTGAATCGCT
GGCGGGACGAAAATTTTCTGCAAACGATTCCAGTCGACCG
ACACTTCAGCAGCGTTTTATGATTATGACAAAATAAGTTT
ATACGAGTTGCACCTTTTGTGGAGTTAGTGCCCGTGATTT
GCAGAGTGGAAATGGTGGCCAGAGGTCAGAAACGAAAGCT
CTGCAGAGACGACGAGGGAGCAGGTTCAGCTTGGGAAAGT
CAGCTGCAGTCTGTGCTGGACATTTCCATGGACAAATACC
AGCGGGACCAGGCTCTGGTGGAGCCCAGCTTATTACGGTC
AGTTCTGATCAACAACACCCTGCGGCAGGTTCAGTCTGAG
GTCCGTGCACAGGTAGACTCACTCTCCCCTCTAAACCAAT
CACAGCCCAAGCCTCAAGATTTTCCTCAAATACTCTCTCC
GGTTGACCGTAACGCATCTCTGTTCTCGCTGAATGCTGAA
AACGTGGAGGAAGATATCACGGGCTGGACATCAGAGGAGG
ATTTCTCATTATCTTCTGCCATCTCTGCCATTCTCAAAGA
TCTAGACGCCATCATCGATGGACCGTCTCAACGTTCTCCA
CTCGGATCCATAGAGAATCTACCAGGGTGTTCAAGTTTGA
GGGCTGAAAAATCATACTTCAGAACAGAGGCCACGTGTCC
AGGTCAAGACGTGTCTTTGGATAAACTACTTATGGACATC
GATTCATCCGTTTTTGAGCCTGAAGTGAATCTCCTGCAAG
GCTTTTCTGATGATTTAGTGAAGTATCTACCATCCTTGTC
CAAATCCCCATCAGCTTCTCCATCTGTGGTTTCTCCAGGT
CAGGCCACATGGGAAATCCAGGAGATCGAGCATGTTATGG
ACTTCCTGATGCGGACGTATCCGTGAAGATGATTTTAATG
ATTGGTTGAGTTATTTAAATGGTTTTTACGGATGTCTTGG
ACATCTAGACATGTAAATGAAGATGGCTTGGCTAAAGCAA
TGCTAAATTTGGACTGCCAGTGAACATCTAATAGACATCC
AAGAAAGGACCAAAACTAGACTAGTCATCAAATACACATT
AAGCCTGATTTATACTTCTGCGTCAGGTGACCGGCGTGAC
CCACGGCGCATGCAACGTGCGTGGCTGGGCATTTATACTT
CTGCGCGCTGTCTCTGTTGGTCTGCATTAACACTTCCGAA
ACGCTAGTTGGCAGTGAGGTGTAAATGTTCCTCTGTGTCA
AGTTTCTTCGCTACTTTTTTGCATTTCCTGAACACTTCCG
AGATGTACAAGTGGCTCAAACTCGCTCATTTTGAGGCAGG
AACCGGCGGACGTGCAATAACTTTAACTATAAGGTAAACA
CAAAACAAAACTTTCCATCCGGAGCTCCTTCACGGGACTC
CACACTTGTAAACAATCACTCGCGCGGCGTCGCGCCATTC
GCGCGGCTCTCGTCCCGTCCAGACTCGTCAGCGCTACTAA
GCCGACCAATCACAGAGCTTACGCTACGCGTCGTTGCGAC
GTGTAGTTACATTTTTTGAGAGGTGCACGTCAGCGATGGC
CACGGCGAAGGGCTATGCGTCAGCGCCGTAGCATACACCG
GCGTTAGACGCAGAAGTATAAATCAGCCTTTAGACAGACA
ACTCATATGTAGTCGTTCATTTTTTGTATTTGATGATTAG
TCTAGATTTGGGCTTTTCTTCGATGTCTATTAGATGTTCA
CTGACAGCCTTATGTTTTACCAAAGCTGTCTATTAGACAT
TTATAAAAGCTTGCTGGGTGACCAGTTGCTCCTCAACAAT
TCCTTCTGCTTTTAAAAGAAGCCCTTTTGTTTTTAAAAAC
AGTCTAATAGACGTCTAAATATAGACAGCTTCATTAAAGC
AAGGCTAAATTTGAGCTGCCAGTGAACATCTAATAGACAT
CCAAGAAAAGACCAAATCAAGACTAGTCATCAAATACAAA
AAAATAAAAGACTACATATGTGAAGTCCGTCTAATCTGTC
TATTTGATGACTAGTCTAGTTTTGGTCTATAATTAGATGT
CTATTAGATGTTCACAGACGGTTTAAATTTAGCCTTGTTT
TAGGCAAGCCCTTTACATTTAGACATCTATTAAACATCTA
TTAGATGTATTTTGAAAACAAAAGGGCTTCTTTAAAAAGC
ACAAGGGCTTGTTGAGGAGTAACTGGTCACCTAGCAAGCA
ATTTTGTTTAAAAAAAAAAAAAAGTTTAATAGACGTCTAA
ACATAGACGGCTTTGGTAAAACATAAAGCTGTCAGTGAAC
ATCTAATAGACATCCAAGAAAGGACCAAATCTAGACTAGT
CATCAAATACAAAAAAATAAACGACTACATATGTGAAGTC
TGTCTAATCTGTATTTGATGACTAGTCTAGTTTTGGTCTG
TTCTTAGATGTCTATTAGATGTTCACAGACAGCTCAAATT
TATCCTTGCTTTAGCCAAGCCATCTTCATCTAGTTGTCTA
TTAGACATTTATTAGACTTTTAAAAGCTCAAGGGCTTGTT
GAGGAGTAATTGGTCACCCAGCAAGCATCTTTTGTATTTA
AAAGAAGTCTAATAGACGTCTAAACAGAAGGTTTCGTTAA
AACGAGGTTAAATTTGAGCTGTCAGTGAACATCTAATAGA
CATCCAAGAAAAGCCCAAATCTTGACTAGTCTACTACATA
TGTGAAGTCTGTCTAATCTGTCTATTTGATGACTGGTCTA
GTTTTGGTCTATAATTAGATGTCTATTAGATGTTCACAGA
CTACTTTGTTTTAGGCTAGTCCTTTACATTTAGACATCTA
TTAAACATCTATTAGATGTCTTTTGAAAACAAAAGGGCTT
CTTTAAAAAGCACAAGGGCTTGTTGAGGAGTAACTGGTCA
CCCAGCAAGCATTTTTTGTTTAAAAAAAAAAAAAAGTCTA
ATAGACGTCTAAACATAGACGGCTTTGGTAAAACATAAGG
CTGTCAGTGAACATCTAATAGACATCGAAAAAAAGTCCAA
ATCTAGACTAATCATCAAATACAAAAAAATAATGACTACA
TATGTGAAGTCTGTCTAATCTGTCTTTGATGACTGGTCTA
GTTTTGGTCTATAATAAGATGTCTATTAGATGTTCACAGA
CAGCTCAAATTTAGCCTCGTTTTAGCCAAACCATCTACGT
TTAGACGTCTATTAGACATCTATTAGACTTTTAAAAGCAC
AAGGGCTTGTTGAGGAGTAACTGGTCACCCAGCAAGCATT
TTTTGTTTTTAAAATAAGTCTAATAGACGTCTAAACATTA
ATTTAAAGATGAATTCCACACAAAGTTCAGCAGGAAGCGT
CCCGTACACAAGTGTTGTGAAGCGAGTCCTTTAAAAAAGT
GCCGTTTTACTATATTATTCTCTAAGATATGCACTTTCCA
TTCGTTCAGAGTCTTACATTTTATAATGCATACTTGAGTC
TTTCATTCGCAGGTTGCCTTTAAGAGTATCCCGTCTGGAT
TAGGTTATTAACATATGAGATATGTGTGTTTATTTTTAAC
TGTAAAGGTATTATAATGTCCGGTTAATGTATAACATGAA
TATACTGGTGCTGTTTCAGATGTGTCGATGCCTATGCAAC
ATATTTACTATTGTCAGTATGAAATTATAATGATGTGTTG
TGATCTGTTGTATGTTTGTGTACTCAAATAAAGAGGTACT
TGGTGACATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations