Transcript

dbi-202

ID
ZDB-TSCRIPT-090929-19913
Name
dbi-202
Previous Names
  • dbi-002
  • zgc:77734-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039649 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039649|OTTDARG00000028951|ZDB-GENE-040426-1861 dbi|OTTDARP00000031703 CH73-250A16.1-002 LG_ CU463316.11 Danio rerio protein_coding KNOWN, 685 bp
ATCATCTCCAGCGGGTTTAGAGGCACAACAGGCTGAATTA
ATCATCTGCAAACATGTCTGAGGCCGAGTTTCAGAAAGCC
GCAGAGGAGGTCAAACAGCTGAAAGCAAAACCAACAGACG
CTGAGATGCTGGAGATCTACAGTCTGTACAAGCAGGCCAC
CGTAGGAGACGTCAACACAGCTCGGCCAGGCATGCTAGAC
TTCACCGGTAAGGCCAAATGGGATGCCTGGGATGCCAAGA
AAGGTTTCCAGCTAGACATGGCGATATTCAGCAATTCAAT
GTATTGTGATAATAAACATGCACCATATTGATATCGTGGC
CACTTCAAAATACAGTGGATAATTGTTTATTTTTAAAATA
ATATTCACATTGTATTAACAGCTTTATAGTTTAATTTTTA
TGTAATCTGACCTACTACAAGCTGAAATATTAATTGTAAA
TTCTGTTAATGTGCATTAACATTGTGCATTCAGACTCTAA
TAGGTAACATTAGCAATTTAACTAAACTACCCCATTATAA
GTTGTAATTGTTTGAATTTCAGTTGTGTCTTGTTTTTAAC
CAATATAACTAACAAATCTGGCTTAATCTCACTGATGAAT
TGAATATAAAGTGTCCTTATAATCCTTTTGCAATTTAATT
CACAATAATTGTTTACTCTATACAATAAAGCAGTATATCA
ACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations