ZFIN ID: ZDB-TSCRIPT-090929-19913
Transcript Name: dbi-202
Previous Names: dbi-002, zgc:77734-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039649 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039649|OTTDARG00000028951|ZDB-GENE-040426-1861 dbi|OTTDARP00000031703 CH73-250A16.1-002 LG_ CU463316.11 Danio rerio protein_coding KNOWN, 685 bp
ATCATCTCCAGCGGGTTTAGAGGCACAACAGGCTGAATTA
ATCATCTGCAAACATGTCTGAGGCCGAGTTTCAGAAAGCC
GCAGAGGAGGTCAAACAGCTGAAAGCAAAACCAACAGACG
CTGAGATGCTGGAGATCTACAGTCTGTACAAGCAGGCCAC
CGTAGGAGACGTCAACACAGCTCGGCCAGGCATGCTAGAC
TTCACCGGTAAGGCCAAATGGGATGCCTGGGATGCCAAGA
AAGGTTTCCAGCTAGACATGGCGATATTCAGCAATTCAAT
GTATTGTGATAATAAACATGCACCATATTGATATCGTGGC
CACTTCAAAATACAGTGGATAATTGTTTATTTTTAAAATA
ATATTCACATTGTATTAACAGCTTTATAGTTTAATTTTTA
TGTAATCTGACCTACTACAAGCTGAAATATTAATTGTAAA
TTCTGTTAATGTGCATTAACATTGTGCATTCAGACTCTAA
TAGGTAACATTAGCAATTTAACTAAACTACCCCATTATAA
GTTGTAATTGTTTGAATTTCAGTTGTGTCTTGTTTTTAAC
CAATATAACTAACAAATCTGGCTTAATCTCACTGATGAAT
TGAATATAAAGTGTCCTTATAATCCTTTTGCAATTTAATT
CACAATAATTGTTTACTCTATACAATAAAGCAGTATATCA
ACAAA

dbi TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dbi-201 (1)    Ensembl 1470
dbi-202 685
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dbi-202 Contained in:
[BAC] CH73-250A16 (1)

Genome Resources: Vega_Trans:OTTDART00000039649 (1),  Ensembl_Trans:ENSDART00000144114 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH502497 (1) 727 nt
GenBank:EH528704 (1) 711 nt
CITATIONS (2)