Transcript

c18h3orf33-201

ID
ZDB-TSCRIPT-090929-19870
Name
c18h3orf33-201
Previous Names
  • c18h3orf33-001
  • c3orf33-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039606 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039606|OTTDARG00000028929|ZDB-GENE-061121-2 c18h3orf33|OTTDARP00000031671 c3orf33-001 LG_ CU570794.4 Danio rerio protein_coding KNOWN, 1747 bp
TCCCTCTGTAAACAACATGCCGTCAGTTCCTGCAGATAAT
ACAGACGATGCTAAACCCTCCAAAAATTTTGTTGCACTTT
TATCAAACTTTGCTGACGATCATTTAACAGTTGTCCGGAG
CATCAGCACATGTATTGGTCTCGCGGGGCTTCTCATAGTA
GCCAGGAGCATCAGACTGATGACCAAATTCGGCTCCGGCA
CTGATATTCCAGCACGGTTCATTGAGAGGAATATCATTAT
TAGAGGACGACTGAGAAATATCACAGAAAAAGGGCTTGAA
GTGGAACACATTCCGATTTCTGTCCCTTTACTCAGTCGCC
TGCTTGCTAAACGTCAGACTGAAGCCCTCCTGGATGTGCG
TTTGGCTGGGGTGGAGTTGACCTCTGAAGGGCACCACTGG
ATCGGTCAACAGCTGAGACCCGCTGAGACAGTTTGGCTCC
GACTGATCGCTCGACAGAACGAGACCCTTCACTGCCTAGT
GTCAGTTAACAAGGGGTCCCTCTTTAACACTTGTGTAAAT
GAGGAACTTTTAAGGCTTGGTTTGGCTAGGACGTCTCCTC
TTGTGGTTCTGGACCCTCACTCTCAGATTTACTGGAGTCT
CTATAAGCGCTTACTTCGCGCTGAAAGCAAAGCTGAGAAA
AAAGGAAAAGGCCTTTGGAAGGAAGAGAGTCGCTGGGAGA
GATTTACTGATGTCTTGAGGAACAATATGCTGCTTGTCTC
ACTTAAGAAACTCTTCAAATGGAGATCTGGTACTAAAGAA
AAGTGAAACATTCCATTTTCCATGTTGGTGATTTGTTTGA
TGTTATTAAATATTTACTTTAAATCAGACTGATCTCAGAC
ATAATTTCAAGAATTAAGGGAGGGAGCACGATTAAACATG
TCCATCCGAGAATGTAAATGTCCATGTGTTATTCTGCTTA
CTGACACTTGTAAAGAATCTCCCCTTCGTGTCTTGCTCAT
GAAGACAGACTGTCTTTACCCCTGCTGTAATGGTTGTAGC
ATTCTATAATCCATCACGTTATTCATGCTGTCCTACACCT
GTAGTGTCGGACCCTGTCATCATACTCCTGACAACCGGAA
AGCCTTTGTACTCTGCCCTCCTCCCATAAATCCATATCCT
ACAGACCTCTCGGTTTTCTCTTTCCCTGGGGAGATGGGGG
AGTGCTTTGTCATGATGACATGGCAGTGGGGGTCTACCAA
TGCCCCTGTGGAGATCCCCATTACTATAGAAACATCACAG
TCTGAAGACAAAGTGTATCAGGGGGGCATTTCTCAGGGTC
CTAAAAGCCATAGTGCTTGTAGAGCACACAACAGAGACTA
CGAGAGGGGGGAAATGCTTGAATACAATAACTATTGTAGT
TCAGAACATTGTTTTCAACTAATATTATGTGGGGTCTAAA
AAACTCAAAAATGCAAAAATAATTTAATTATTAAAAATGT
TACATCATGCATGTGAATTGTAAATTGGTATTCAGAACGT
TGTAGAATCTATGCAGATGCTATTTTTCTCTACTAAGTAG
AGCCAACTTAATAGTTTTAGTCATTTTCACCTATCTATGT
GACTAGGGAGGAGAAACACAAGAGAAAAGTTTTTCCAGTT
GTGTACATTGCTGTGGTGTAAATGTACTCTGTGTTTGCTT
ACATTGTCTGTAAAAAAACACAGCATTCCAAAAAAACATT
TTATTTGTTTCACATGATTTTATTGCGATTTCATGAGGGA
AAATAAAGATAACTGAAGCACATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations