Transcript

rad21l1-201

ID
ZDB-TSCRIPT-090929-19850
Name
rad21l1-201
Previous Names
  • rad21l1-001
  • zgc:154013-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039586 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039586|OTTDARG00000028918|ZDB-GENE-061103-505 rad21l1|OTTDARP00000031654 CH1073-428E6.1-001 LG_ CU467960.4 Danio rerio protein_coding KNOWN, 2179 bp
AAATCGATTCCTGTTGATGAACTTTGAGCGGCAACAGATA
TAACTTAACGTACCACACACGCCGAGATGTTTTATGCCCA
ACTCTTCACCTCTAAACGAGGGACACTCGCCAAAATCTGG
CTCGCAGCCCACTGGGAGAAGAAAATAACCAAAGCCCACG
TGTTTGAATGTGACTTAGAGACTACCATCAAGGAAATCCT
GTCTCCCCAGATTAAAATCGGTCTGCGAACATCAGGTCAC
CTGCTTTTAGGAGTGGTGAGGATTTACTCAAGGAAGACCA
GATACCTTCTGGCAGACTGCAGTGATGCGCTGGTCAAAAT
CAAAGTGGCTTTTCGTCCAGGACAGACCGATCTACCTGAT
GATGCGATGGAGGCCACCTTAAAAACTATTACTTTACCAG
AGGATTTCACAGACTTTGACTCTCAGCTGCCTGATCTGAA
CACCATTGATGTGGTAGACCACTTCTCTTTGAATCAGTGC
CGCACTGAAGATATTACTCTCAAAGAGAACTTCGGGAACC
TCTTTCTCAGCTTGGAGAGAATAGGGGAAGAAATGCAGTC
TTACCAAGGATTGTTTGATCAGAGTTTCAGTGTCCATGGC
GACTGCTTTGGAGATGAGGAAATGGCCGTTGACCTCATTG
ATATTATAGCGAATACAGCTGAGGACACTCTGATGTCTGA
TTTCAATGGAAACTCTATTAATGAATTGCCAGCTACACCT
CCTCCAACTGCTGTCAACGCAGTAGAACCGGAGAAACCAG
AAACTTCCTGTTTAAAAGAAAGGAGCAGTCCAGATGTGAC
TGAGACCACTTTCCTGGTAAACGAAGACGAAGGTTTTGCT
CTTGCACCTGTTTCTGCCACACCTTGTTCAGCAAAGAAAA
GGAAGGTGAGGAAGCGTAAGCTGGTGATTGACCGGTCAAA
GCAGCTAACTAACAGCGCCATCAGGGATCAGCTGGCGGAC
TGCTCTGACATTTTATCCCCGCTGGAGATTGCCCCGCCCA
CTCGCCAGCTGATGGAGTGGCGGGAGAGCGGAGGAGTGAA
GCAGCTGATCTCAAGCTTTTGCCTTCCTGTTCTTCATCCT
GACTTAAAGCAGCTGTTCCCTTCTGAGGTGTCACCTAGGA
GACAGGGCTTGAAGGGAGGAGCGAGACAGCAGACTGACCC
CGAAGAGATGAGGGAGCAAACTAGAGAGGCAGTAGAAGAG
GACACTGTTCAGCCAGTGATGGATGACTGGAGTTTACTGC
AAGACTCTGTTGCTCAAGAACAGCCAGTAGATGCAGACAC
TACTCTAGAAGATTCTGTTTGTCATCCAGAGCCTCCACCT
TCCTGGAACAGCACCATTGAGAGTAGGTTGGAGGTGTCGT
ATCCAGAGCCTCAGTCTGAGATCTCCACGCTCAGTCATCC
ATCTGTAGAGATGAGGGAAACCCCACTGGTGACAAAAACA
CAATCAGTTCTGGGCAGCCAGGATTTGGAGGACAGAAGAA
TGACCAGTCGGGCACACGATCTCCTCCAGGCCCTCAAAAG
TCAAGACTCTTCTCCCGATGCAGTGTACAGTCTTCATGCT
TTATGTGAGAGCGGCAGCCGTTCATACGTGGCAGCCTTAT
TTTTCTGCATGCTTGTGTTAAGAAAGCAACAATTCCTCAA
CCTCCATCAGAGCGCCCCATACAGTGACATCATCGCCACA
CCTGGGCCTCTCTTTCACTCCATCTAGAGCAGCTAGACAT
GCAGCAGTGGAGGAAAACATTTGTGAGTTTGATTTTGGTC
TCGCACGTCTTCTTGGTTGAAAGTAATTTTGATGGATTTC
TGTCAAAAAAAAAGTCGATTTGTTATGAATCCCTATGGAG
AAGCGTTCAAAACAATGGCATGCATCTGTGTGGTGTTTCT
AAAACAGTGGGTTGAGCTGTGGTAGAGAAGAAGTGTAGAG
CAGCAAGCAGCCCAGTATGTTGTCTGCATATGAAATGGTC
ACTAATATGATTTGATTTTTATCATTCAGTTTAAGTAGTT
GAATGAATTAAACTGACCAACATTTGTTCATTCCTTTGAA
ACTTAAGCCGTAATAGGTTGTAAAGTAGTAATAGAGTTCT
ACTATGTGTTCGTTACTATGATCTGTTTGCTCTTTTCACT
GTCTTTAAAAAACATTAAAGGATAAATGAAATTAATAAAT
TTTGCAAAAGTTAAAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations