Transcript

acap3a-202

ID
ZDB-TSCRIPT-090929-19787
Name
acap3a-202
Previous Names
  • acap3a-001
  • si:dkey-229p15.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039494 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039494|OTTDARG00000028859|ZDB-GENE-030131-1711 acap3a|OTTDARP00000031591 DKEY-229P15.5-001 LG_ CR926464.12 Danio rerio protein_coding NOVEL, 1454 bp
GCAAGAAAAGGAGGCCTGGATTAAGGCGAAGTATGTGGAG
AAGAAGTTTCTGAAGAAGATGATGACGGGTGAGGTTGTGG
TGAACGGCGGGAGGAAATCTGAGCGGCGCTGGAACTCCAG
AAAGTGCAGGAGGCACAACAGTGCCACAACCGTCCCCAAA
ACACACCGCAAATACAGGCAGGATCCAGGCAGTGCATCTC
CAGCAACCCTGTCCTCAGCAACTGCTGCTCTGGAGAGAAA
GTTCAGACGGGAATCGCTCTTCTGCCCGGATGAGTTAGAC
AACCTCTTTTCCTATTTCGACACTGGTTCAGGGCCTCGCA
GTCCTACAGGTCTGAGCAGTGACAGTGGGTTAGGAGGCAG
CACTGACGGCAGCACTGACGTCTTGGTGTTCGAGTCTGTG
GTGGACAGCGTCACAGAGGAGGAGTGTGAGGTGTCTGAGG
ACTCTAGTAATGAGGCTGAACTGGAGCCAGAAGCATCAGA
TCCTGAGGACTCGAGAGAGCTGGATGCTGGAGCGTTACTC
TACAAGGCCTGTCAGGCACGCAATTTGCCTGTTATGGCCG
AAGCTCTGGCACACGGAGCCGACGTCAACTCTGTCAATGA
AGAGGACGAGGGGAAAAGCCCGCTCATTCAGGCTGTGATT
GGGGGTTCTTTAATAGCCTGCGAGTTTCTGCTGCAAAATA
GTGCTGATGTGAACCAGAGAGATCACAGGGGAAGAGGCCC
GCTGCATCACGCCACTTATTTAGGACACACTGGGCAAGTG
TGCTTGTTTCTGAAACGAGGAGCAACTCAAAACGACGGGG
ATGAGGATGGACAGGACCCGCTGAGCATAGCGGTTCAAGC
GGCTAACGCTGATATCGTTACTCTGTTACGTCTGGCACGG
ATGAATGAGGAGATGCGCGAGTCGGAGGGCCCGTTCGGCC
AGCCAGGTGACACCACATACCTGGATATTTTCCGAGAGTT
TTCCCACATGGCATCCCACAATCCGGAGAAGCTGAAGCGG
AGAAGTGTTCACTTCCGTCACTCCTTCAGAGTGTGAACGA
GCCATCGACACCAATTTTTGGACACCAATCCAGCTGGAGC
AGAAGACACTTTGACTGGCTGTTTTCAAATGAGTGATGGA
CTTTATTCAGCAAATTGTGGTCATGTTTTGTGTATTTTAA
TGATATTTTTATAGCTTTATGAGGGTGAGCTGGACTTAAC
CCTGCAGTGTTTGGTCTATTTTCTTTATTTGTCTTCTGCT
TTAGTTAGACAGTAAAAGCACATGCACACCAAGAACAATA
ACTATAAAGAAACAGTATAAAGATTACTTTATTACCATCC
ACAATAATGCACAAAAATATTCTGTTTATGTTATGCGAAC
GTTTATCTGGATGGATTCTTATGATTGGCTTATTTCATTC
TGGATGAAATTTTTCTGAAAGTGCACAAATAACATTCTTC
TGTTTTGTTTTTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations