ZFIN ID: ZDB-TSCRIPT-090929-19787
Transcript Name: acap3a-202
Previous Names: acap3a-001, si:dkey-229p15.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039494 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039494|OTTDARG00000028859|ZDB-GENE-030131-1711 acap3a|OTTDARP00000031591 DKEY-229P15.5-001 LG_ CR926464.12 Danio rerio protein_coding NOVEL, 1454 bp
GCAAGAAAAGGAGGCCTGGATTAAGGCGAAGTATGTGGAG
AAGAAGTTTCTGAAGAAGATGATGACGGGTGAGGTTGTGG
TGAACGGCGGGAGGAAATCTGAGCGGCGCTGGAACTCCAG
AAAGTGCAGGAGGCACAACAGTGCCACAACCGTCCCCAAA
ACACACCGCAAATACAGGCAGGATCCAGGCAGTGCATCTC
CAGCAACCCTGTCCTCAGCAACTGCTGCTCTGGAGAGAAA
GTTCAGACGGGAATCGCTCTTCTGCCCGGATGAGTTAGAC
AACCTCTTTTCCTATTTCGACACTGGTTCAGGGCCTCGCA
GTCCTACAGGTCTGAGCAGTGACAGTGGGTTAGGAGGCAG
CACTGACGGCAGCACTGACGTCTTGGTGTTCGAGTCTGTG
GTGGACAGCGTCACAGAGGAGGAGTGTGAGGTGTCTGAGG
ACTCTAGTAATGAGGCTGAACTGGAGCCAGAAGCATCAGA
TCCTGAGGACTCGAGAGAGCTGGATGCTGGAGCGTTACTC
TACAAGGCCTGTCAGGCACGCAATTTGCCTGTTATGGCCG
AAGCTCTGGCACACGGAGCCGACGTCAACTCTGTCAATGA
AGAGGACGAGGGGAAAAGCCCGCTCATTCAGGCTGTGATT
GGGGGTTCTTTAATAGCCTGCGAGTTTCTGCTGCAAAATA
GTGCTGATGTGAACCAGAGAGATCACAGGGGAAGAGGCCC
GCTGCATCACGCCACTTATTTAGGACACACTGGGCAAGTG
TGCTTGTTTCTGAAACGAGGAGCAACTCAAAACGACGGGG
ATGAGGATGGACAGGACCCGCTGAGCATAGCGGTTCAAGC
GGCTAACGCTGATATCGTTACTCTGTTACGTCTGGCACGG
ATGAATGAGGAGATGCGCGAGTCGGAGGGCCCGTTCGGCC
AGCCAGGTGACACCACATACCTGGATATTTTCCGAGAGTT
TTCCCACATGGCATCCCACAATCCGGAGAAGCTGAAGCGG
AGAAGTGTTCACTTCCGTCACTCCTTCAGAGTGTGAACGA
GCCATCGACACCAATTTTTGGACACCAATCCAGCTGGAGC
AGAAGACACTTTGACTGGCTGTTTTCAAATGAGTGATGGA
CTTTATTCAGCAAATTGTGGTCATGTTTTGTGTATTTTAA
TGATATTTTTATAGCTTTATGAGGGTGAGCTGGACTTAAC
CCTGCAGTGTTTGGTCTATTTTCTTTATTTGTCTTCTGCT
TTAGTTAGACAGTAAAAGCACATGCACACCAAGAACAATA
ACTATAAAGAAACAGTATAAAGATTACTTTATTACCATCC
ACAATAATGCACAAAAATATTCTGTTTATGTTATGCGAAC
GTTTATCTGGATGGATTCTTATGATTGGCTTATTTCATTC
TGGATGAAATTTTTCTGAAAGTGCACAAATAACATTCTTC
TGTTTTGTTTTTGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acap3a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000039494 (1),  Ensembl_Trans:ENSDART00000139563 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT641096 (1) 812 nt
GenBank:BI673536 (1) 626 nt
GenBank:BI672770 (1) 516 nt
CITATIONS (3)