Transcript

rps29-201

ID
ZDB-TSCRIPT-090929-19785
Name
rps29-201
Previous Names
  • rps29-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039492 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039492|OTTDARG00000028857|ZDB-GENE-040622-5 rps29|OTTDARP00000031589 rps29-001 LG_ CU633785.7 Danio rerio protein_coding KNOWN, 346 bp
GTCTTTTTTGCGCCTGCGCACAAGATCCACTTCCTTTTCG
ACATCCCGATCGAGAGAGACGAGATGGGCCATCAGCAGCT
CTACTGGAGTCACCCTAGAAAATACGGCCAGGGCTCGAGA
TCCTGCCGGGTTTGCTCAAACCGTCACGGACTGATCCGTA
AATACGGACTCAACATGTGCCGTCAGTGCTTCAGGCAGTA
CGCTAAAGACATCGGCTTCGTCAAGCTGGATTAAACGAGT
GAACGGCTGAACTTTCATGATGGGGAGTCAACATCATTCC
AGTCCAACCTGACGTCATGAAGTTACTGTGGAAAATACAA
TAAACACTTTGTTTTGTTTCTGTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations